Beta
×

Welcome to the Slashdot Beta site -- learn more here. Use the link in the footer or click here to return to the Classic version of Slashdot.

Thank you!

Before you choose to head back to the Classic look of the site, we'd appreciate it if you share your thoughts on the Beta; your feedback is what drives our ongoing development.

Beta is different and we value you taking the time to try it out. Please take a look at the changes we've made in Beta and  learn more about it. Thanks for reading, and for making the site better!

Review of Discovery Institute's Evolution Textbook

ScuttleMonkey posted more than 6 years ago | from the just-partner-it-with-dawkins'-god-delusion dept.

Education 756

Darwinned writes "Intelligent Design is still a hot topic, as evidenced by recent legislation mandating that it be taught in school. Pro-ID group Discovery Institute has released an evolution textbook for use in schools, but a review shows it to be chock full of bad science and questionable reasoning. 'The book doesn't only promote stupidity, it demands it. In every way except its use of the actual term, this is a creationist book, but its authors are expecting that legislators and the courts will be too stupid to notice that, or to remember that the Supreme Court has declared teaching creationism an unconstitutional imposition of religion.'"

Sorry! There are no comments related to the filter you selected.

Am I a first poster? (-1, Troll)

Anonymous Coward | more than 6 years ago | (#25172667)

indubitably

Evolution textbook!? (0)

Anonymous Coward | more than 6 years ago | (#25172691)

Evolution is a subject now? :P

SCOTUS reference anybody? (3, Insightful)

jdogalt (961241) | more than 6 years ago | (#25172693)

"
  remember that the Supreme Court has declared teaching creationism an unconstitutional imposition of religion
"

Can someone post a reference. I suspect any actual rulings will be somewhat more nuanced than that broad statement.

Re:SCOTUS reference anybody? (5, Informative)

jandrese (485) | more than 6 years ago | (#25172799)

The grandparent was probably referring to Edwards v. Aguillard [talkorigins.org] .

Re:SCOTUS reference anybody? (1)

jarom (899827) | more than 6 years ago | (#25173193)

As far as I read it, the Supreme Court declared that you can't pass a law forcing people to teach creationism.
That is different from declaring it is unconstitutional to teach creationism, which is what the great-grandparent says.

Re:SCOTUS reference anybody? (1, Insightful)

Anonymous Coward | more than 6 years ago | (#25172971)

No scotus reference will support this broad claim. As a practical matter, though, most cases indicate that teaching creationism in science classes in public k-12 schools may be an unconstitutional endorsement of religion.

America is evolving backwards (-1)

Anonymous Coward | more than 6 years ago | (#25172721)

if the rest of the news is to be believed
why are so many high-profile Americans intent on destroying their country? (financially,morally,scientifically),
seems like a spoilt child breaking its toys, what gives ? are you doing this on purpose ?

Table Of Contents (5, Funny)

darth_MALL (657218) | more than 6 years ago | (#25172723)

1 - In The Beginning...

2 - The Great Flood (Where are all the Unicorns?)

3 - Jesus, Dinosaur Wrangler

4 - Darwin, What a Jerk.

5 - The Scientific Method - Hooey or Baloney?

2 - The Great Flood (Where are all the Unicorns?) (4, Insightful)

rossdee (243626) | more than 6 years ago | (#25172901)

Were Unicorns mentioned in the Bible before Noah? (The Irish Rovers song doesn't count)

Anyway I think that the Slashdot usage of the term "Creationism" should be replaced by the phrase "Young Earth Creationism"
(YEC for short)

There are people of many Faiths that believe in Creation and a Creator, but that the Creation event was many (billions) of years ago, not 4004BC, and that the cosmos and the creatures therin have evolved over that (long) time.

Re:2 - The Great Flood (Where are all the Unicorns (1, Interesting)

gardyloo (512791) | more than 6 years ago | (#25172957)

Anyway I think that the Slashdot usage of the term "Creationism" should be replaced by the phrase "Young Earth Creationism"
(YEC for short)

Perhaps. At least the YECers have the balls to believe in something which is not only demonstrably inane, but has been disproven many times. Those OECers simply relegate their creator to misty Planck times. I call that moving the goalposts to a spot where they do no one any good whatsoever.

Re:2 - The Great Flood (Where are all the Unicorns (5, Insightful)

Free the Cowards (1280296) | more than 6 years ago | (#25173209)

Ah, but the beauty of YEC is that it really can't be disproven. Any time you have evidence that the Earth is older, all they need to say is that God created it to look older.

This is fundamentally why YEC should not be taught in a science classroom. It is not disprovable and thus not science.

Re:2 - The Great Flood (Where are all the Unicorns (5, Funny)

Wonko the Sane (25252) | more than 6 years ago | (#25173299)

--
Fuck y'all.

Your ideas are intriguing to me and I wish to subscribe to your newsletter.

Re:2 - The Great Flood (Where are all the Unicorns (4, Insightful)

bcrowell (177657) | more than 6 years ago | (#25173279)

Anyway I think that the Slashdot usage of the term "Creationism" should be replaced by the phrase "Young Earth Creationism" (YEC for short)

That would be very convenient for the creationists, because YEC is disappearing these days. The creationists have learned that if they make definite scientific statements (e.g, that the Earth is 6000 years old), they risk being proved wrong by scientific evidence. Instead, they've learned to say vague, fuzzy things about intelligent design, while avoiding making testable statements about facts.

There are people of many Faiths that believe in Creation and a Creator, but that the Creation event was many (billions) of years ago, not 4004BC, and that the cosmos and the creatures therin have evolved over that (long) time.

Right, and those people aren't creationists. The wikipedia article gives a good definition of creationism: "Creationism is the religious belief that humanity, life, the Earth, and the universe were created in their original form by a deity (often the Abrahamic God of Judaism, Christianity and Islam) or deities, whose existence is presupposed.[1] In relation to the creation-evolution controversy the term creationism (or strict creationism) is commonly used to refer to religiously-motivated rejection of evolution.[2]" In other words, the commonly accepted definition of creationism is that it's in contradistinction to evolution, so the people you're describing, who accept evolution, aren't creationists. "Creationism" is just one of those words that doesn't mean exactly what you'd think it meant based on its etymology. For comparison, "communism" doesn't mean belief that people should live in communes, and a "Republican" in the US isn't defined as someone who's happy that our form of government is a republic.

Re:2 - The Great Flood (Where are all the Unicorns (1)

d34thm0nk3y (653414) | more than 6 years ago | (#25173335)

Anyway I think that the Slashdot usage of the term "Creationism" should be replaced by the phrase "Young Earth Creationism" (YEC for short)

Slashdotters, everyone else on the planet, and dictionary writers you mean...

Creationism Defined: [reference.com]

Some excerpts:

the doctrine that matter and all things were created, substantially as they now exist, by an omnipotent Creator, and not gradually evolved or developed.

Belief in the literal interpretation of the account of the creation of the universe and of all living things related in the Bible.

the literal belief in the account of Creation given in the Book of Genesis; "creationism denies the theory of evolution of species"

Yeah (1, Funny)

nawcom (941663) | more than 6 years ago | (#25172729)

"The book doesn't only promote stupidity, it demands it."

What were people expecting? A book made by stupid people to promote intelligence?

Re:Yeah (0)

Anonymous Coward | more than 6 years ago | (#25172745)

Darwin's Black Box anybody. Whether or not you agree w/ his conclusions or not he does not make a stupid argument.

Re:Yeah (2, Insightful)

nawcom (941663) | more than 6 years ago | (#25172801)

Please RTFA and understand what this textbook contains. If you really think the word stupidity (or lack of intelligence) doesn't match the description, then science and technology really isn't your thing. Hand in your geek card, Coward.

Re:Yeah (4, Informative)

MojoRilla (591502) | more than 6 years ago | (#25172991)

Darwin's Black Box anybody. Whether or not you agree w/ his conclusions or not he does not make a stupid argument.

Darwin's Black Box [wikipedia.org] was shown to be wrong in the Dover trial. Behe's central premise that things are irreducibly complex was proven wrong both with hard scientific data (about the flagella being irreduceably complex, but the bacterial Type III secretory system has a subset of the parts, though they serve a different function) and logically (Behe says a mousetrap is irreducibly complex, but it is useful as a tie clip if you remove two key parts).

The judge in the Dover trial summed it up by saying [wikipedia.org] :

We therefore find that Professor Behe's claim for irreducible complexity has been refuted in peer-reviewed research papers and has been rejected by the scientific community at large.

Re:Yeah (4, Insightful)

Free the Cowards (1280296) | more than 6 years ago | (#25173251)

Regardless of those two examples, the entire concept of irreducible complexity is complete bullshit.

Evolution does not simply add parts. It also removes them. And indeed there is a great incentive for this to happen, as every unnecessary part is an added metabolic cost to the organism which contains it.

So let's say for a moment that some structure was discovered that were irreducibly complex. Does that disprove evolution? Absolutely not! It just means that the structure evolved from something more complex, not less.

Re:Yeah (1, Insightful)

philspear (1142299) | more than 6 years ago | (#25172783)

What were people expecting? That goes both ways.

"A biologist reviews an evolution textbook from the ID camp"

The conclusion: it's crap.

OMFG!!!

Next up: the writer of the inteligent design textbook reacts to the review. Don't want to spoil the ending, but he MAY not be convinced!

Re:Yeah (5, Insightful)

JetJaguar (1539) | more than 6 years ago | (#25173323)

You can imply that there is bias all you want, but there is one very big difference between the two. The biologist has studied biology, the scientific process involved in researching the subject and is able to make an evidenced based critique of an ID argument.

Rebuttals from the ID camp contain no such expertise or references, and are usually based on long refuted arguments against evolution, but little or nothing that truly supports ID.

This isn't a case where he-said she-said attempts to discredit both sides will work. One side clearly has evidence on their side, and the other does not.

Re:Yeah (-1, Flamebait)

Spy der Mann (805235) | more than 6 years ago | (#25172909)

What infuriates me is the hypocrite naming. "Discovery Institute" (what on Earth are they discovering? Or was the name chosen to make people fall for the similarity between that and the Discovery Channel?), "evolution textbook", "intelligent design" that make their idiocy sound intelligent (just as "patriot act" and similar initiatives). And they use deception so blatantly to promote their "truth"?

What happened to the traditional Christianity that preached "love thy neighbor"? I still fail to recognize the point where America stopped being a christian nation to become a nation of intolerant hypocrites.

Re:Yeah (1)

ScrewMaster (602015) | more than 6 years ago | (#25172989)

What happened to the traditional Christianity that preached "love thy neighbor"?

That means "have sex with the neighbor girl" nowadays. I want to know what happened to the Christianity that taught that lying was wrong.

Re:Yeah (1)

JetJaguar (1539) | more than 6 years ago | (#25173351)

What happened to the traditional Christianity that preached "love thy neighbor"?

Where have you been? That part of Christianity pretty much disappeared within days of Christ's crucifixion (assuming it even happened in the first place).

revenge on the nerds (5, Insightful)

Phantom of the Opera (1867) | more than 6 years ago | (#25172739)

In the US, its not fashionable to know math or science. It's not fashionable to work hard. 'Being liked' is in. Girls are encouraged to look pretty and boys are encouraged to be force wielding leaders (to later wind up as PHB's?).

Look at kids' movies and TV shows. The message is that all you have to do is believe in yourself. Nothing else. God forbid we ask these delicate flowers to do more than the minimum.

Prosperity is being taken as a birthright. I half wonder if the outcry against illegal aliens is due to the fact that these people work hard. The complainers may one day be expected to. Can't have that!

Re:revenge on the nerds (1)

wrf3 (314267) | more than 6 years ago | (#25172867)

In the US, its not fashionable to know math or science. It's not fashionable to work hard.

And why is this? What has changed about out culture that these things are no longer valued? The secularists among us might argue that "religion" has affected math and science, but I think this a false argument. Speaking to what I know from personal experience, Christians are opposed to naturalism, but not math or science. My middle child, for example, is pursing advanced studies in MEMS. And, certainly, there used to be something called the Protestant work ethic.

'Being liked' is in. Girls are encouraged to look pretty and boys are encouraged to be force wielding leaders (to later wind up as PHB's?).

So what caused the shift from an emphasis on inward appearance to outward? Why force as a tool of leadership, instead of love?

Look at kids' movies and TV shows. The message is that all you have to do is believe in yourself. Nothing else.

Hmmm... +5 Insigtful if I had mod points.

Re:revenge on the nerds (2, Insightful)

Phantom of the Opera (1867) | more than 6 years ago | (#25173069)

In the US, its not fashionable to know math or science. It's not fashionable to work hard.

And why is this? What has changed about out culture that these things are no longer valued?

I wish I knew. When is the last time we as a people have been asked to sacrifice or had to sacrifice? That's not necessarily a bad thing, but my grandparents' generation lived through WWII and the great depression.

The secularists among us might argue that "religion" has affected math and science, but I think this a false argument.

I agree with you. Religion is not opposed to philosophy, science or thought. I think it is a culture that has. This culture tends (IMHO) to be a rabid form of the Christian right with a tribal 'we are better than you' attitude.

Speaking to what I know from personal experience, Christians are opposed to naturalism, but not math or science. My middle child, for example, is pursing advanced studies in MEMS. And, certainly, there used to be something called the Protestant work ethic.

The textbook in question stems from a lack of sophisticated thought. I would rate it more tribal and political than religious. I'd doubt it would hold up to real religious scrutiny.

'Being liked' is in. Girls are encouraged to look pretty and boys are encouraged to be force wielding leaders (to later wind up as PHB's?).

So what caused the shift from an emphasis on inward appearance to outward? Why force as a tool of leadership, instead of love?

Force is faster. This is a society of convenience. The timing of TV's changed our perceptions. Love might take weeks, but blowing something up - that's seen to resolve in the alloted 1/2 hour or hour.

I blame TV a lot, probably too much.

Re:revenge on the nerds (2, Insightful)

linzeal (197905) | more than 6 years ago | (#25173187)

Too many parents worldwide use religion as a way to discipline this blurs the line between normative and natural laws. Some middle eastern and african societies have taken this and established broad regimes of terror based on their "holy" religions. Countries based on other ideologies such as humanism, socialism and even capitalism typically do not act in such wanton ways. These other sorts of countries may instigate violence and many times the violence they have instigated has been horrific but it has never been so shown to be so pervasively inhuman in modern times unless religion was involved. Serbs with their hateful xtian idealogy, Sudan and their arabs vs everyone, and the Sino Emperor Worship cult.

Re:revenge on the nerds (1)

laddiebuck (868690) | more than 6 years ago | (#25173265)

Consumerism.

Re:revenge on the nerds (1)

Kamineko (851857) | more than 6 years ago | (#25172919)

Back in my day, the after school special would say both 'Believe in yourself.' and 'Stay in school.'... Sonic Sez!

Re:revenge on the nerds (0)

Anonymous Coward | more than 6 years ago | (#25172965)

Though I must admit that Sonic never actually said either of those things. Maybe I was thinking of something else.

Re:revenge on the nerds (1)

dpilot (134227) | more than 6 years ago | (#25173133)

> Prosperity is being taken as a birthright. I half wonder if the outcry against illegal
> aliens is due to the fact that these people work hard.

I'm caught between agreeing with you on this, and thinking that you just sound like a spoiled brat CxO who doesn't want to share any of "his hard-earned money" with his employees who did most of the real work. Speaking of "Prosperity is being taken as a birthright," certainly our CxO crew has taken that one to new heights - 270X (on average) higher than the people that they insist complain too much and want too much for too little work. Not to mention that as they took home 270X the average worker's pay, they managed to completely screw the US industrial/development base, and the economy itself, to boot. I'd say we got much better service back when that number was only 40X.

Re:revenge on the nerds (1)

Phantom of the Opera (1867) | more than 6 years ago | (#25173277)

I'm caught between agreeing with you on this, and thinking that you just sound like a spoiled brat CxO who doesn't want to share any of "his hard-earned money" with his employees who did most of the real work.

Heh, if only! No, my parents are teachers and I'm just a coder. As to those top earnings, my opinions are expressed here : http://slashdot.org/comments.pl?sid=965813&cid=25028569 [slashdot.org]

Re:revenge on the nerds (1)

TheModelEskimo (968202) | more than 6 years ago | (#25173141)

This point of view (not fashionable to know math or work hard) has been manufactured in part by advertising groups. Do a Google search for a combination of the terms "mook" and "midriff" and you'll find out why, and how this happened.

Basically, they present Mooks and Midriffs in the media to make people buy in to their products. Mooks and Midriffs are the type of people who make big corporations rich.

Re:revenge on the nerds (1)

Rinikusu (28164) | more than 6 years ago | (#25173153)

Huh? Name a time in history where this wasn't true? The best and brightest have been getting dumped on since time immemoriam (sp?).

pardon? (1)

Phantom of the Opera (1867) | more than 6 years ago | (#25173347)

Huh? Name a time in history where this wasn't true? The best and brightest have been getting dumped on since time immemoriam (sp?).

I don't think this was true for most of history. I don't even think it was true for the early part of the 20th century. Doctors and scientists and engineers were admired or at least respected. In the 19th century, 'The Origin of Species' was a popular read. Don't forget the enlightenment, Confucius, the renaissance, the philosophers of Greece and Germany. In India and China, people work extremely hard to get into universities. It's the utmost honour to be the one from your villiage to get to go.

Re:revenge on the nerds (1)

Quiet_Desperation (858215) | more than 6 years ago | (#25173319)

Look at kids' movies and TV shows. The message is that all you have to do is believe in yourself. Nothing else.

Yeah! It's that evil Spongebob! Corrupting our youth and tainting their precious bodily fluids! Grrr! Damn his yellow, porous absorbency!

So let them. (1, Interesting)

ivandavidoff (969036) | more than 6 years ago | (#25172749)

Why are we fighting this? It's futile. Let them believe what they will believe, let them teach what they want. We've been fighting this battle since the first caveman got brained by his devout brethren for dissing the volcano god. We'll never win. Might as well leverage the ignorance of the masses somehow, like Elmer Gantry.

Re:So let them. (4, Insightful)

bigbigbison (104532) | more than 6 years ago | (#25172791)

Mainly because they don't only want to teach their children this stuff but they want to force public schools to teach every child this stuff. It is a slippery slope. Once they teach "the controversy" what else will they want to tech?

I'm sorry (3, Funny)

way2trivial (601132) | more than 6 years ago | (#25172837)

are you suggestion that there is any occasion where it is proper to diss the volcano god?

What the hell is wrong with you- do you want to be responsible for the entire town burning down?

don't you care about your neighbors or family at all?

dang- move far away from everyone before you say anything like that again please.

Re:So let them. (0)

Anonymous Coward | more than 6 years ago | (#25172879)

Well, "we" are fighting this because they want to use our tax money to make our children as stupid as their children. But hey, I can afford to send my kid to private school, so what the hell. Let them make proles out of as many kids as possible. It will only improve the quality of life for the rest of us.

Re:So let them. (1)

compro01 (777531) | more than 6 years ago | (#25173261)

You forgot something important. In this reality, those proles vote.

Re:So let them. (4, Insightful)

Spy der Mann (805235) | more than 6 years ago | (#25172935)

Why are we fighting this? It's futile. Let them believe what they will believe, let them teach what they want

If that's the case, why are you posting your own opinion on slashdot? Let the slashdot readers believe what they will believe and let the submitters submit what they want.

You fail to understand that if they do WHATEVER IT TAKES to convince other people of their truth, those converted people will do WHATEVER IT TAKES to convince EVERYONE of their truth. If we don't do anything to stop them, soon it will be 1984 all over the country. And I'd say we're on the edge of seeing that happening.

Re:So let them. (0)

Anonymous Coward | more than 6 years ago | (#25173109)

You're right on some level, but there are limits. Call me crazy, but I would like science to be taught in science class in school, not religion dressed up as science, and not BOGUS criticisms of science that have been obviously crafted to support a particular religious view. It's at the point that people try to squeeze non-science (or bogus science) into science classes that I will object, because I'm a scientist, a citizen, and a parent. It would be irresponsible to just let it go.

Belief? It's got nothing to do with it. People should believe whatever they want, and students especially. But that's no excuse for students not knowing anything about current science. There are too many important issues in the world where good decisions depend upon an understanding of science. People need to be informed. Why should you take all the antibiotics that your doctor prescribes? Why shouldn't we use antibiotics in everything? (Answer: because you don't want to drive the evolution of resistant strains). Biological evolution leads to understandings that SAVE LIVES. And that's just one theory and a couple of issues.

Ceding science education to whatever other topic merely claims to be scientific is ridiculous. What next? Teach astrology in in astronomy class? Teach phlogiston in chemistry? Teach the aether in physics class? Sure, mention them as historically interesting, but as valid theories or legitimate criticisms of the current thinking in these fields? On equal terms? That's just nuts.

Believe? Sure. Whatever people like. And I'll defend their right. But, no, I won't stand by and let people teach any old nonsense as science. If they want to teach this other stuff, do it in a comparative religion course or philosophy.

Re:So let them. (5, Insightful)

Free the Cowards (1280296) | more than 6 years ago | (#25173291)

When I'm a decade or two older, the young people who will be affected by these decisions today will just be entering the workforce, bringing their bright new ideas into focus, and beginning to drive the next round of scientific and technological advances.

I do not want these people to believe that one of the most successful, important, and useful scientific theories in history is a lie. I do not want these people to believe that "God did it" is any kind of reasonable scientific answer. I don't want the doctors and medical researchers who determine the length and quality of my old age to be spouting off about "irreducible complexity" and other such nonsense.

You're wrong about losing the battle. Here we are conversing on a globe-spanning information network using unimaginably powerful computing machines. We've always won, and we'll keep on winning, because in the end we're right and they're wrong. But it won't be thanks to people like you.

Intelligent Design, Stupid Tactics (4, Insightful)

cliffiecee (136220) | more than 6 years ago | (#25172809)

What's really bugged me the most about Intelligent Design is that its proponents attacked the wrong target.

As I understand science, it's a cycle: observe, explain, hypothesize, test; and repeat. Evolution as a theory, holds to this cycle. But Intelligent Design is just: observe and explain- the explanation being essentially "God did it." There's not much reason to keep examining things when you feel you've reached that stage, is it? It's an intellectual dead end.

If *I* were in charge of promoting/legitimizing ID, I would put it up against the Big Bang/String theorists and the like. When we can't yet explain why the universe is the way it is on a fundamental (quantum?) level, *THAT's* when you can trot out the "God did it"s. Evolution is just too well researched and tested a subject to topple (logically and rationally, that is).

Re:Intelligent Design, Stupid Tactics (0, Troll)

ChuckSchwab (813568) | more than 6 years ago | (#25172995)

Evolution as a theory

And there you reveal the fundamental weakness of modern education. I mean, think about it. We're demanding that students be taught evolution in science classes, even though evolution is still basically just a theory at this point ... er, just like intelligent design.

Science should be about teaching students SOLID, known facts, not "theories". They should learn about gravity and atomic interaction and optics and the kinds of rocks and plate techtonics. They should not be taught some bizarre dream that some guy hobbled together based on a few coincidental pieces of evidence. That's just not what science is.

Evolution is a theory. That's all it ever has been and all it ever will be. We'll never be able to actually go out and test evolution. All we really have is faith, and that's exactly why it's important to teach students about alternate belief systems. I still think evolution should be taught in science class because obviously you have to be on the up and up about what's going on. But the same reasoning applies to intelligent design, which has made great advances in understanding life at the biochemical level.

So really, let's keep science reality-based, and teach students ALL sides, not just the ones that are most politically popular. Don't be so insecure in your beliefs that you have to ban everything else.

Re:Intelligent Design, Stupid Tactics (1, Insightful)

Anonymous Coward | more than 6 years ago | (#25173161)

Not this again.

A theory is just a falsifiable statement of how things work. Theories can either be supported by evidence (e.g., evolution) or not.

Evolution is both a theory and a fact. Microevolution has been SEEN. It's not up for debate. It's a fact. Macroevolution is so well supported by evidence that only the ignorant doubt it. About the only thing that is questionable in all of evolution is abiogenesis, but oddly the I.D. kooks rarely go after it preferring to focus on how "we're not evolved from monkeys."

Intelligent Design is not a scientific theory. It's not falsifiable because it relies on an intelligent designer which, by definition, cannot be proven not to exist.

So there is really only one "side" to this debate as far as science is concerned. Now, if you want I.D. taught in schools, might I suggest dropping the designer part to make it falsifiable and then busting your ass for the next 200 years to get even a shred of the evidence that evolution has already acquired in support of itself.

Re:Intelligent Design, Stupid Tactics (0)

Anonymous Coward | more than 6 years ago | (#25173167)

Nice troll there. Thanks for doing my job!

Re:Intelligent Design, Stupid Tactics (4, Informative)

Wonko the Sane (25252) | more than 6 years ago | (#25173257)

Evolution is a theory. That's all it ever has been and all it ever will be.

Just like gravity

We'll never be able to actually go out and test evolution.

False [justfuckinggoogleit.com]

But the same reasoning applies to intelligent design, which has made great advances in understanding life at the biochemical level.

Citation needed [wikipedia.org]

Re:Intelligent Design, Stupid Tactics (2, Insightful)

Free the Cowards (1280296) | more than 6 years ago | (#25173305)

I'm sorry, gravity is a fact? Show it to me. I say that things fall down because they like the Earth and want to be happy.

Atomic interactions are fact? Have you ever seen an atom? Show one to me, then maybe I'll believe it's a fact.

Optics? Binoculars work because God shows you a clearer, larger image. Telescopes show lies about the Universe because they are the Devil's devices.

Plate tectonics are obviously not facts. The Earth was created only 6000 years ago, don't you know. Plate tectonics would have no time to function over such a short period.

Go on, tell me why I should take all of those as "fact" but evolution is "just a theory". I can't wait.

Re:Intelligent Design, Stupid Tactics (5, Insightful)

Torontoman (829262) | more than 6 years ago | (#25172999)

ID is about as legit as Scientology.

Re:Intelligent Design, Stupid Tactics (4, Insightful)

99BottlesOfBeerInMyF (813746) | more than 6 years ago | (#25173137)

What's really bugged me the most about Intelligent Design is that its proponents attacked the wrong target.

That's because you and the religious fundamentalist leaders have different goals.

If *I* were in charge of promoting/legitimizing ID, I would put it up against the Big Bang/String theorists and the like.

ID isn't about finding science that is sufficiently speculative and trying to insert "God". It's about finding science that is sufficiently confusing to the average person so that some will be able to be convinced while others will not. If there isn't strong controversy, then people don't get emotional and angry and feel they need to fight and give exploiters money to help with the fight.

If they weren't laughed at so hard, they'd be arguing that the sun revolves around the earth, because that is in conflict with absurdly literal interpretations of the bible. In fact, in some poorly educated communities, they are making that argument. It's just too absurd for the mainstream US (who can understand enough astronomy or at least see the pictures, to understand otherwise). So they pick the most outrageous untruth possible that they can talk a significant number of ignorant saps into believing. That way there are two "sides" and the religious can feel they are being attacked and need to strike back, by sending their money in and casting their votes to fight for their religion... even though mainstream christianity moved on and has accepted evolution (and heliocentrism) for a long time.

Evolution is just too well researched and tested a subject to topple (logically and rationally, that is).

And that is where you fail. They aren't interested in logic or reason, but in emotionally charged attacks and intentionally spread confusion as a way of manipulating the sheep. Seriously, how many of these so called scientists and preachers do you think have any interest in really promoting christianity instead of making a buck or getting elected? If they were really christians they'd be focusing on the core message of Jesus, which is still not well understood; things like reacting to violence with nonviolence and treating people you disagree with peacefully and respectfully in spite of said disagreement.

Re:Intelligent Design, Stupid Tactics (0, Flamebait)

methuselah (31331) | more than 6 years ago | (#25173359)

wow your cynicism and bigotry are profound. i would like to point out that all the crap you are spouting was shoved into your head by people with agendas also. if you weren't a narrow minded brainwashed non thinking minion of the leftist pseudo intelligentsia and were capable of independent thought of any kind you would read what you just wrote and apologize for being an idiot, jerk, and hypocrite. oh and your belief system sucks too.

Re:Intelligent Design, Stupid Tactics (1)

eball (1315601) | more than 6 years ago | (#25173149)

Because young people, the easiest to indoctrinate, don't know about the creation of the cosmos yet. But even an 8 year old can say "Wait, if the earth is only 6000 years old, when did this T. Rex on my T-shirt live?" In other words, you have to defend your idea on the grounds by which it is most easily disproved. If someone says "There is evidence in the layers of the earth that there was no flood, and that you are an idiot," you can't just say "Well, string theory doesn't explain that either." You have to defend yourself, no matter how bad of a job you do at it, on the grounds on which you are being challenged.

Re:Intelligent Design, Stupid Tactics (1)

Concerned Onlooker (473481) | more than 6 years ago | (#25173155)

"When we can't yet explain why the universe is the way it is on a fundamental (quantum?) level, *THAT's* when you can trot out the "God did it"s. "

No. That's exactly what ID does today. Whenever science doesn't have a quick and ready answer for something then the creationists automatically attribute it to "god." When we can't explain why something is the way it is it simply means there is not enough data or technique to discover the answer. It does not mean that some mythical being created the thing in question.

You had it right at first. To be legit ID will have to complete the cycle of observe, hypothesize and test until they've gathered enough data to form a--you guessed it--theory.

Re:Intelligent Design, Stupid Tactics (1)

Vellmont (569020) | more than 6 years ago | (#25173289)


When we can't yet explain why the universe is the way it is on a fundamental (quantum?) level, *THAT's* when you can trot out the "God did it"s

That [wikipedia.org] hasn't [wikipedia.org] worked [wikipedia.org] well [wikipedia.org] historically [wikipedia.org] speaking [wikipedia.org]

Let the idiots be idiots (2, Insightful)

Luscious868 (679143) | more than 6 years ago | (#25172847)

Let the wingnuts in Kansas and other red states teach creationism or any other loony idea they want and let those of us who are in the blue states teach real science and math and critical thinking skills and let's see which population is more successful in our knowledge based economy 10 - 20 years down the road. Let the free market decide, as they say, with one condition. Let's do away with welfare and let the religious nut jobs who aren't interested in teaching science, math and critical thinking reap what they sew.

NO. (1)

J_Omega (709711) | more than 6 years ago | (#25173037)

You should desire to really inform those who are getting taught his crap. Realize that the ID/Creationism movement is from the adults - they just force the (idiotic) ideas on the children who have no say in the matter, and are confused enough as is. Hey, if an adult tells them that's how the world works, the'll believe it. Better that the kids are taught the real-deal so that this stuff isn't propagated to their children's children's children.

If "red state" values dominate, who gets elected? who runs this place? who tells YOU how to live your own life?

Think of the children?

Re:Let the idiots be idiots (1)

spazdor (902907) | more than 6 years ago | (#25173065)

This would be perfect reasoning if not for the fact that kids don't get to choose their parents.

Your plan is to punish an entire generation of kids for the poor reasoning skills of their parents.

Re:Let the idiots be idiots (1)

jeevesbond (1066726) | more than 6 years ago | (#25173275)

Let the wingnuts in Kansas and other red states teach creationism or any other loony idea they want and let those of us who are in the blue states teach real science and math and critical thinking skills and let's see which population is more successful in our knowledge based economy 10 - 20 years down the road.

I'm a Brit, and used to think like this too. What does it matter if a bunch of them crazy Yanks believe the world was created 6,000 years ago? Unfortunately for us critical thinkers, daft [bbc.co.uk] ideas [slashdot.org] spread [michaelgeist.ca] . And now we have the Internet, stupid ideas can travel like wildfire.

One thing we need to learn: no state, province, county or country has a monopoly on stupidity. Being an idiot really is a game the whole family can play! :)

Re:Let the idiots be idiots (1)

couchslug (175151) | more than 6 years ago | (#25173303)

That's not a bad idea. I favor a parental opt-out for science and biology classes because both sides MUST like the outcome.

The Christian Taliban can avoid polluting their young with evil ideas, and we can avoid polluting scientific fields with Superstitionists. Christians must like this choice because it cannot have a bad outcome for them.

This is a war where neither side will be convinced of anything different, so non-Superstitionists should leverage superstition to maneuver Superstitionists out of the way.

As learning science and technology becomes more demanding, the barrier to entry will be higher. Self-imposed barriers to entry by people we don't need there in the first place can usefully backfire. Religionists in the US are Fundamentally enemies of science (the tiny number on Slashdot don't matter) so the thing to do is exactly what their leaders do. Provide choices they will want to accept because of their beliefs. We have every right and social duty to manipulate these people in this manner.

gotta love it (0)

Anonymous Coward | more than 6 years ago | (#25172855)

Intelligent Design... "Science you must believe in"

(and if you disbelieve, they will burn you at the stake.)

No, it doesn't. (1, Troll)

Empiric (675968) | more than 6 years ago | (#25172863)

Simple fact is, an extensive elaboration on, say, the Copenhagen Interpretation versus the Everett Interpretation, -even were one demonstrated false-, would not "promote stupidity", much less "demand" it. Simply having to follow the arguments to critically evaluate the question at hand, -even if 100% of the students thus rejected ID-, would do nothing but increase the students familiarity with the biological questions at hand, and challenge them to be able to analytically utilize them.

However, this last statement does strike me as fully representative of the overall politicalization of the question the reviewer engages in throughout (at least he explicitly states he's doing so, justifying it by saying it's "where ID started", even though that's false in ID's case, it started with Behe publishing a book on biochem and its implications on evolutionary theory), and the overall tinge of a kind of deep defensive bias the piece reeks of.

Particularly funny was the part where he chides the book for not anticipating evidence that he presumes of-course will be found, which is basically tantamount to concluding a particular sub-issue on the basis on -no present evidence-, something he'd never let ID get away with.

Standard straw-man of representing ID as simply the most easily-dismissed notion of "Creationism" of anyone on the planet, standard ignoring of the fact that "evolution happens" is not actually debated by anyone advocating ID, and his particular meaning equivocating it to "only evolution happens" is fully scientifically untestable, and will never change from being untestable, and that desire to conclude such causal exclusivity for the -actual- motivation at hand is simply a non-sequitur, even were it testable.

The main thing that bothers me is the cultural framework this creates of closing science into dogma. Since we currently can do genetic engineering, and there's some possibility that intelligent life will be discovered as having existed in the past nearby, maybe some civilization nearby visited Earth and, since we can already do it, went ahead and... oops. Can't propose that, and since I can't propose it, can't ever investigate it. Academic crimestop.

Anyway, I'm heading out for the weekend, so I doubt I'll be able to follow up to any replies right away. Since Natural Selection will inevitably take care of my response for me, though, I won't worry about it too much. Later.

Re:No, it doesn't. (3, Insightful)

Sebastopol (189276) | more than 6 years ago | (#25172987)

In your first paragraph, you are making an a priori assumption that schools which teach ID also teach critical thought. I find that very unlikely, since acceptiong ID requires limited critical thinking abilities.

As per the bias of the reviewer, well that's pretty obvious. I think part of the reason impartial dialog is becoming increasingly scare among evolution proponents is due to the techniques ID proponents have employed. While I agree the entire debate needs to be had at a lower grade level, so that everyone can partake, I don't think the maturity should sink to the same grade level. And I'm certain this last statement appears biased to a pro ID reader.

The main thing that bothers me is the cultural framework this creates of closing science into dogma.

What was that about strawmen? /grin

There's more science in "Doc Smith". (1)

argent (18001) | more than 6 years ago | (#25173103)

This isn't like comparing the Copenhagen Interpretation and the Everett-Wheeler-Graham model, this is like comparing the Copenhagen Interpretation and Scientology. Not only does ID make claims about edge cases that, with further investigation, are found to support the standard model of natural selection, but ID doesn't even serve its original purpose. It isn't even Biblically supported: ID contradicts the fundamentalist reading of Genesis just as systematically as the standard models.

Since we currently can do genetic engineering, and there's some possibility that intelligent life will be discovered as having existed in the past nearby, maybe some civilization nearby visited Earth and, since we can already do it, went ahead and... oops. Can't propose that, and since I can't propose it, can't ever investigate it. Academic crimestop.

Not only can you propose that, but there is active research into the existence of complex extraterrestrial life on Earth (by looking for evidence of life in the interior of meteorite fragments), in the solar system (pretty much every probe sent to Mars and quite a few other places has included experiments looking for evidence of life), and beyond (not just project SETI, but things like research into the possibility of the intelligent origin of pulsars... before we figured out what they were).

Re:No, it doesn't. (1)

spazdor (902907) | more than 6 years ago | (#25173105)

"evolution happens" is not actually debated by anyone advocating ID

[citation needed]

Re:No, it doesn't. (0)

Anonymous Coward | more than 6 years ago | (#25173115)

Particularly funny was the part where he chides the book for not anticipating evidence that he presumes of-course will be found, which is basically tantamount to concluding a particular sub-issue on the basis on -no present evidence-, something he'd never let ID get away with.

This is a pretty solid example of why your post isn't "insightful". The author actually chided the textbook for not _allowing for the possibility_ that more evidence could be found. The textbook concluded that bats appeared suddenly because no early fossils of bat-like creatures had been discovered. How is it possible to draw a conclusion based on a _lack_ of evidence. Of course the article then goes on to claim that such a fossil was discovered recently...

Sorry, but it looks like you just didn't understand the article.

Re:No, it doesn't. (1)

PCM2 (4486) | more than 6 years ago | (#25173179)

I know you're a troll, but...

The main thing that bothers me is the cultural framework this creates of closing science into dogma. Since we currently can do genetic engineering, and there's some possibility that intelligent life will be discovered as having existed in the past nearby, maybe some civilization nearby visited Earth and, since we can already do it, went ahead and... oops. Can't propose that, and since I can't propose it, can't ever investigate it. Academic crimestop.

That's just silly. Of course you can propose it. Who's stopping you? For the sake of argument, let's assume you have proposed the idea that aliens from a nearby planet came to Earth and genetically modified early organisms to turn them into people. Now what? What form of "investigation" do you propose?

Scientists are actively searching for nearby planets that are capable of supporting life, and if they find any they will actively investigate whether any life exists on them, intelligent or not. So in a way, that part of your hypothesis is already being tested. The problem is, so far we have found absolutely no evidence of life anywhere else in the universe.

You could propose the theory that mermen from beneath the sea created humans, and suggest that if we searched the vast expanse of the oceans for long enough we might actually encounter evidence of these mermen -- fine. It's plausible enough; the oceans certainly are huge and there's a lot in them that we don't know about. But this is really two theories in one. So far, there is no evidence to support your first premise -- mermen created humans -- because we have never seen evidence of any mermen. And in fact, insofar as we have undersea craft roaming the Earth at all times, we are constantly conducting experiments to locate mermen (much in the same way that the LHC will search for the Higgs boson) -- and, unfortunately, we have not found any. No mermen, no mermen creating humans. Simple as that.

Just because scientists choose not to pursue certain experiments doesn't mean they are closed-minded or involved in some conspiracy. Suppose I have a piece of paper in my hand. I tell you that if I let go of this piece of paper, it will descend to the ground at exactly the same rate of speed every time. That's my theory. To prove this theory to you, I drop the piece of paper. Then I repeat the experiment. In total, I drop the piece of paper 1,134 times. Upon examining the data, I find that the paper hit the ground after roughly the same interval, repeatedly, 1,133 times. But one time, the paper flew out of my hand and landed on the other side of my room. Is this evidence that my theory about gravity is unsound? By strict scientific method, yes is is -- but which is the more likely explanation? That the action of gravity has changed, or that the front door blew open when I was conducting that one trial? Which "investigation" into those results will be more fruitful?

Scientists are expected to conduct their research with rigor and detachment, and not bias their research based on ideology. But nothing in the handbook says they have to act as if they're stupid.

Re:No, it doesn't. (1)

Adrian Lopez (2615) | more than 6 years ago | (#25173207)

"Since we currently can do genetic engineering, and there's some possibility that intelligent life will be discovered as having existed in the past nearby, maybe some civilization nearby visited Earth and, since we can already do it, went ahead and... oops. Can't propose that, and since I can't propose it, can't ever investigate it. Academic crimestop."

If life on Earth had indeed been created by intelligent beings from outer space and evidence of that fact were provided, I am sure no honest scientist would oppose the teaching of such a theory.

Of course, there is absolutely no evidence for such a claim, so at the moment it's nothing more than pure speculation and therefore does not belong in science class. Speculation is not synonymous with theory, and It's not "academic crimestop" to prevent the teaching of nonsense in our public schools. In fact, preventing its teaching it's the only responsible thing to do.

Re:No, it doesn't. (0)

Anonymous Coward | more than 6 years ago | (#25173333)

"The main thing that bothers me is the cultural framework this creates of closing science into dogma."

You're missing the whole point of the review: what's presented as criticism of evolutionary theory is a BOGUS criticism, backed up by poor information (i.e. already known to be wrong or out of date), misunderstanding of the predictions of the theory, unnecessarily chopped-up consideration of topics in isolation, and flawed logic. It's not that criticism of this or any other science is disallowed -- of course it is allowed, and it is crucial to encourage criticism and critical thinking in science classes. The whole review endorses that basic principle. What the review criticizes in the book is the very poor implementation of that principle. It's so poor that (according to the review) it would probably do more harm to students' understanding than any good.

A good scientific or teaching principle doesn't work well if you feed bad data into the process. It "promotes stupidity" because if you use the information in that book you are leading the students in an exercise about critical thinking using bogus data. All you are going to get out of that is a great deal of confusion. I half wonder if the Discovery Institute would be content with that outcome (we'll see if they promptly revise the book).

Have a good weekend.

Personally (-1, Troll)

mikesd81 (518581) | more than 6 years ago | (#25172883)

I subscribe to the Creation theory. However, I don't think either theory should be taught in science classes. Science should be taught not unprovable theories. No one can prove Evolution nor can anyone prove Creation. If they're to be taught in school, put it under Literature like where I learned the Mayan's version of the creation of life.

Re:Personally (3, Insightful)

Liquidrage (640463) | more than 6 years ago | (#25172945)

Sadly in places people defend your ignorant view. As if there's a middle road here. "Teach both", or "there's room for more then one theory".

Evolution is one of the cornerstones for modern biology. You don't want it taught even though it has withstood over 100 years of scrutiny and is incredibly accepted by the scientific community? Why? Because you don't understand it most likely.

Re:Personally (1)

ScrewMaster (602015) | more than 6 years ago | (#25173053)

Because you don't understand it most likely.

That's most likely true ... he understands only what those "religious leaders" with an agenda want him to understand (nothing, in other words) and he doesn't want to question their authority and learn more on his own. I mean, how many people of faith do you know that are convinced that the Theory of Evolution teaches how life was created and thus detracts from the glory of God? Darwin's Theory says nothing about the origins of life, it only predicts how life changes over time. Yet that single misunderstanding is at the center of much of the hate and discontent.

Then, of course, there are the even more ignorant types that just can't stand the thought that humans are nothing but slightly-more-evolved monkeys.

Re:Personally (4, Insightful)

Liquidrage (640463) | more than 6 years ago | (#25173235)

Years ago when Georgia was going through the ID vs Evolution in school issue I saw the national media on site at a high school ask a local student his thoughts. He responded that he wanted ID taught because he knew evolution was full of holes and he could disprove it himself.

Well step up young man and claim your Nobel prize that's waiting you.

Where did he get his (mis)information from? It's not the local drug dealers. It's not the science classes. It's not video games.
It's the churches.

There are many churches that deal in lies to peddle their agenda of pushing evolution out of the classroom. It's not a conspiracy theory it's a fact of life in this country.
If man came from monkeys why are there still monkeys? People ask that because they've been told that. They've been told that is a hole in evolutionary theory so they parrot it. They aren't told that at the drive through line at McDonalds. They are only told that type of information in religious circles.

I used to argue with Answers in Genesis for years. It was like pulling teeth trying to get them to remove content that was completely non-factual or completely taken out of context. Letter after letter would be sent with references to the correct information, but it would take months or years (or sometimes never) to get them to correct their website. Even though they updated their site regularly. There was no incentive for them to provide correct information because incorrect information is the only way they could build their case against evolution.

The fact that some Christians can't reconcile their religion with a very well grounded theory that has withstood the rigors of science for over 100 years isn't my problem.

"No one can prove Evolution"??? (3, Informative)

Nicolas MONNET (4727) | more than 6 years ago | (#25172997)

WTF are you talking about?
Why do you think Evolution is on less solid grounds than, say, quantum theory or heliocentrism?
For heliocentrism, we have probes and satellites taking nice pictures.
For evolution, we have fossils backed by geology, chemistry, atomic physics and so on; we also have ****DNA*** fucking SEQUENCING. Where do you think biologist get those ATTAACGGGCGTGTAAGGCGTGAAA ... ? Random number generators? Do you have an alternate explanation for Polymerase Chain Reaction? Well then, if you agree with DNA sequencing, how do you explain that everything we sequence fits just right with evolutionary theory?
Evolution is much more obvious than most of quantum physics or relativity. Do you also have an opinion about frame dragging or black body radiation? What about tunnel effect?
What does your bible (or whatever source of superstition is it you use) say about the wave-particle duality? Isn't THAT weirder than natural selection? C'm'on, genes mutate and unfit individuals don't get to reproduce. That's straightforward. But Hawking's radiation? The Standard Model? Is more or less problematic to you than the evolution of species by the means of natural selection?
And we both agree that alchemy shouldn't be taught in the classroom, are you going to ask that chemistry, too, be withheld? What about astrology and astronomy?

Mod parent up (1)

zerkshop (1222778) | more than 6 years ago | (#25173239)

Mod parent up!!!

Its hard to be believe how ignorant people's arguments can be like the GP's. Or should I say, contradictory?

If evolution isn't provable, thats like saying any science shouldn't be taught because it's not provable.

"Creation theory subscribers" should just stop getting vaccines, using modern technology, etc etc :)

Re:Personally (1)

Fastolfe (1470) | more than 6 years ago | (#25173095)

Except evolution can be proven: scientists regularly evolve new lines of insects, bacteria, and other rapidly reproducing forms of life. Applying the same concepts to life all over the world is just taking a sufficiently large step back so that you can see the bigger picture. Examining the world and coming up with natural explanations that can be experimentally tested is the very essence of the scientific method, which makes it perfectly appropriate to teach in a science classroom. I would support discussing creationism in a science classroom too, but only to teach children why it's not a scientific theory.

Don't confuse evolution with abiogenesis [wikipedia.org] , and take a read through Evolution as theory and fact [wikipedia.org] .

Re:Personally (0)

Anonymous Coward | more than 6 years ago | (#25173119)

Good idea. Some other theories we might as well throw out while we are at it: gravity, circuit theory, plate tectonics, control theory, general relativity ect...

Re:Personally (1)

Reality Master 101 (179095) | more than 6 years ago | (#25173191)

No one can prove Evolution nor can anyone prove Creation.

Er, considering evolution has been observed (yes, including new species creation), I don't know how much more proof you need. Of course, creation as described in the Bible has zero observable evidence.

Unless you mean human evolution, and yes, barring a time machine, we can't directly observe pre-humans changing into humans. We can only look at the mountain of fossil evidence showing clear pre-human bones that bear no resemblance to anything else except humans. But I suspect that no amount of evidence is good enough for you.

Re:Personally (3, Insightful)

ScrewMaster (602015) | more than 6 years ago | (#25173217)

I subscribe to the Creation theory.

No, you do not. You subscribe to an unsupported and unsupportable myth, and see nothing wrong with your personal mythology being taught to children as established fact. That makes you not only ignorant, but dangerous. Look, the human race already suffered through a long interval of ignorance and misery, with reason taking a back seat to religion. We know that time as the Dark Ages. People who clung to their beliefs in spite of all evidence to the contrary were responsible, and it could happen again.

We'll see how your faith holds up when the lights go out for good. Civilization is fragile. Believe it.

Science...It Works.... (5, Funny)

RiffRafff (234408) | more than 6 years ago | (#25172973)

I saw a t-shirt the other day that said:

SCIENCE
It Works, Bitches!

I thought it was funny...

Re:Science...It Works.... (1)

eball (1315601) | more than 6 years ago | (#25173063)

It's xkcd!

Re:Science...It Works.... (2, Informative)

Shaitan Apistos (1104613) | more than 6 years ago | (#25173079)

xkcd store [xkcd.com]

About halfway down the page fyi.

Re:Science...It Works.... (1)

Bogtha (906264) | more than 6 years ago | (#25173269)

If you are looking for science t-shirts, these ones [wearscience.com] are pretty cool. They have a teach the controversy [wearscience.com] section that's pretty relevant to this discussion too.

"Chock full of bad science"? (2, Interesting)

Anonymous Coward | more than 6 years ago | (#25173031)

The Slashdot blurb implies that the review shows the book to be "chock full of bad science", yet I didn't get that impression from the review.

The first section of the review dealt with politics, not science.

The second section claimed that the "scientific community" overwhelmingly accepts evolution.

Finally on the second page of the review, the implication is made that it's unscientific to be precise about definitions ("neodarwinianism") since the rest of the community prefers the term "evolution" (which is a VERY plastic term that can mean almost anything depending on who you talk to and what part of the sentence just came out of their mouth).

The next "unscientific" claim the review "refutes" is the idea of common descent. Well, duh! That IS the issue, isn't it? "You don't accept my science therefore your claim is unscientific." Pfft.

Then the review objects to the book's criticizing the views of scientists with whom the reviewer doesn't agree anyway. The reviewer claims that the book is using these examples of molehills to build mountains. Maybe, but is it a "chock-full" of "bad science" to criticize faulty viewpoints?

Then the review seems to find fault with the book for calling attention to real controversies in biology, as if that's playing unfairly.

The review even seems to claim that although we still, after 150 years, have limitations in our fossil record, it's a "bait and switch" to mention therefore that some scientists doubt that the fossil record supports common descent.

The review seems to take offense for the book's claim that Darwin's "Tree of Life" has in recent years come to look more like an orchard of bushes. As I understand the state of the fossil record, the book is more correct on this point than is the reviewer. The review also seems to claim that cladistic trees match molecular trees, which I am quite confident is not the case (read an article on that just the other day - sorry, don't recall the citation).

The review downplays the significance of the Cambrian Explosion, claiming that to look at it the way the book does is faulty. And one of the reviewer's arguments is that the sudden appearance of the bat is offset by the sudden appearance of an earlier bat. What?!

The review takes offense at Behe's "irreducible complexity", claiming that at least three scientific papers have refuted Behe. I'm a little familiar with those claims; those claims don't convince me (particularly since they've not been demonstrated, but merely are "just so" stories that "might" be how it happened).

Don't get me wrong; I'm not saying the book is good, or bad; I don't know; I haven't seen it myself. But I definitely get the impression that this review is more an emotionally-charged response to a challenge to a religiously-held belief system. The battle-cry of "bad science" is just a banner under which the faithful will be expected to gather.

Why? (3, Insightful)

Psychotria (953670) | more than 6 years ago | (#25173045)

I don't live in the US, but have read heaps about this topic. My real question is why the subject is even being considered being added to the US school curriculum. There are lame attempts and arguments that go along the line of we want to be "balanced", but, frankly, creationism is not accepted science (it doesn't even come close to science). It's great to debate these things (it broadens our minds), but schools should teach fact; not conjecture.

Evolution is not "fact" either (although the accumulated data supports the theory). If another theory comes along that explains the data better, then Darwin's theory will be superseded. This is how science works. Teaching crackpot "theories" in schools doesn't end up making people more objective. I would suggest that it teaches them to be more stupid. Teach critical thinking. Don't teach things that are not falsifiable. It's easy.

It's not a debate it's arguing absurdity.

Re:Why? (1)

Fastolfe (1470) | more than 6 years ago | (#25173189)

So this is a bit of nitpicking, but since you made your anti-fact claim so strongly, I thought I might respond: Evolution actually has two senses, both fact and theory [wikipedia.org] , and neither should be confused with abiogenesis [wikipedia.org] , which is what creationists frequently mean (attack) when they say evolution. The observed facts of evolution aren't going to be "superseded" by anything, but the theory behind it could be (just like any other scientific theory). Evolution is happening, and if a person doesn't believe that, then no amount of debate or logic is going to convince them otherwise, because they can't even see the data. This goes beyond not being a "science type" and suggests some form of mental impairment, IMO.

Re:Why? (1)

Psychotria (953670) | more than 6 years ago | (#25173249)

You're saying the same thing that I attempted and, obviously, failed to present. Thank-you for doing what I could not.

Re:Why? (1)

ScrewMaster (602015) | more than 6 years ago | (#25173321)

Hey, you did okay. A lot better than any Creationist.

Re:Why? (2, Informative)

99BottlesOfBeerInMyF (813746) | more than 6 years ago | (#25173237)

I don't live in the US, but have read heaps about this topic. My real question is why the subject is even being considered being added to the US school curriculum.

Money.

Seriously, televangelists have made bucketloads of cash by making people feel like they are persecuted or like "those people" are trying to force them to change. Politicians get elected using the same. They use that money to market misinformation and undermine education. It's just a way to make money and gain power.

In most countries there is not a lot of profit in misinforming citizens in that way, so no one does it and said misinformation is less intentional. Marketing works if it is well funded which is why the US is slightly less educated than Latvia on the topic of evolution. The same phenomenon can be seen in both the US and (to a lesser extent) the UK on the topic of global warming. There isn't a lot of serious scientific debate on the fundamentals of either issue, but due to huge marketing expenditures, there's a lot of debate and disagreement among the average people, who don't read scientific journals or critically assess facts, but who do watch TV and believe some of what they see.

Re:Why? (1)

Free the Cowards (1280296) | more than 6 years ago | (#25173349)

Two reasons.

1) The US has a lot of crazy religious fundamentalists who think that their religion should govern all aspects of their (and everyone else's) lives. They are not content to teach their children about it and go to church on Sunday. They want all aspects of society to aid them in religiously indoctrinating their children, especially school. Evolution runs contrary to their beliefs and rather than put their children into a different school, they wish to change the school that everyone goes to.

2) The US has weak voter turnout and a nearly 50/50 split between the two big parties. This gives small but vocal and politically active groups such as this a disproportionately large influence on government, as it's considerably more difficult to win any sort of office without their support.

Epicurus said it best (5, Informative)

thermian (1267986) | more than 6 years ago | (#25173047)

The Riddle of Epicurus
~~~~~~~~~~~~~

If God is willing to prevent evil, but is not able to
Then He is not omnipotent.

If He is able, but not willing
Then He is malevolent.

If He is both able and willing
Then whence cometh evil?

If He is neither able nor willing
Then why call Him God?

~~~~~~~~~~~~~~

Back on topic, the Discovery institute is dedicated solely to enriching its members, any other claim is nonsense.

No more mortgages for Negroes or Wetbacks! (0)

Anonymous Coward | more than 6 years ago | (#25173055)

Financial crisis? Blame the Negro! The colored people did not pay back their mortgages (mortages mandated by Bill "Blow Job" Clinton). Because the banks were forced to loan money to Negroes, when the Negroes failed to make their mortgage payments, the banks began to suffer.

The Negro and the pro-Negro agitators are the heart of the banking crisis.

Do NOT vote for Negroes!

preaching to the choir (4, Insightful)

circletimessquare (444983) | more than 6 years ago | (#25173077)

(pun intended)

i don't think you are going to find much support for this textbook on slashdot

however, what you will find is a lot "hear, hear" and then... nothing. or worse, cynicism

there's a lot of issues in this world where all you can do is whine and bitch and moan, and are otherwise helpless to effect change. this is not one of those issues

ALL of these creationist initiatives are happening on state and local levels. you CAN do something about it if you live in one of these areas

if you do live in an area creationists are making headway, do something about it, please. if for nothing than else than simple civic pride, that the residents of your {state/ town} are not all ignorant buffoons, that some of you actually understand the value of a critical mind, and even more importantly, understand the value of an involved electorate and citizens active for causes they believe in

how is it possible that such idiots can get creationism in our schools? because THEY GET INVOLVED

there are too many voices here on slashdot that will speak loudly about right and wrong, and never actually get involved to make sure their government stands up for that

please, do not feed me the standard psychological lines of learned helplessness that convinces you you can effect no change on this issue or that issue. on creationism, on a state and local level, you CAN do something about this. you SHOULD do something about this. DO IT

if not you, who?

Re:preaching to the choir (1)

Free the Cowards (1280296) | more than 6 years ago | (#25173361)

i don't think you are going to find much support for this textbook on slashdot

however, what you will find is a lot "hear, hear" and then... nothing. or worse, cynicism

It is amusing how your comment is posted below a metric crapload of comments talking about how mainstream science is wrong, how ID should be taught in schools, how the reviewer is biased, etc. Yes, the stupid people are here too!

Dear Students (1)

baggins2001 (697667) | more than 6 years ago | (#25173145)

The lesson for this semester, will be an extraordianary example of how people can be full of shit. Notice how there arguments don't fit together and that when you boil it all down and examine it, basically they are saying " Poof and it was there". Basically they are saying David Blaine is god and created the Universe.

Let's compare this with a book by Charles Darwin called "Origin of Species"....................

Discovery Institute Takes on Gravity Myth (2, Funny)

H0NGK0NGPH00EY (210370) | more than 6 years ago | (#25173195)

This story from the Seattle-area satire paper The Naked Loon seems relevant: Discovery Institute Takes on Gravity Myth [nakedloon.com]

Hot on the heels of a recent Louisiana victory in the fight against evolution, the Seattle-based think tank Discovery Institute held a press conference Thursday to announce their latest initiative: defeating the myth of gravity.

Robert Crowther, Discoveryâ(TM)s director of communications was visibly excited as he detailed the Instituteâ(TM)s plan for attacking what he refers to as the sloppy, inaccurate, and overtly biased portrayal of the theory of gravity.

Bad Science all around. (1, Insightful)

LWATCDR (28044) | more than 6 years ago | (#25173225)

Before the mindless pro science zelots go off on their little snits.
I will state the simple truth. There is no creditable evidence for creationism and it can not be taught in school as a theory of equal standing with Evolution.

But this little bit from the story makes my blood run cold as well.
"The scientific community has very valid reasons for accepting evolution as an accurate description of the history and current development of life on earth,"
Yes this is right.
" reasons that are so so compelling that aspects of the theory can be safely treated as fact."
NO! NO! NO! NO!
No theory in science can be safely treated as fact. A fact is something that is proven and not open to question.

In science every theory is disposable. Newtons theory of gravity worked for a long time but we had to toss it when it started to fail. It wasn't the truth. It was the nearest that we could get to the truth at that time.
Evolution right now is the closest we can get to the truth at this time. We are refining it all the time and hopefully getting closer and closer to the truth.
And please quite calling the people that believe in it stupid. Frankly most of the people that will post how stupid they are have just about the same depth of knowledge as the people that believe in creationism. They just have happened to have guess right in this subject.
 

Re:Bad Science all around. (1)

ScrewMaster (602015) | more than 6 years ago | (#25173345)

" reasons that are so so compelling that aspects of the theory can be safely treated as fact."

Yes, the observational portions of the Theory of Evolution can, indeed, be treated as fact because, well, they are.
Load More Comments
Slashdot Login

Need an Account?

Forgot your password?