Beta
×

Welcome to the Slashdot Beta site -- learn more here. Use the link in the footer or click here to return to the Classic version of Slashdot.

Thank you!

Before you choose to head back to the Classic look of the site, we'd appreciate it if you share your thoughts on the Beta; your feedback is what drives our ongoing development.

Beta is different and we value you taking the time to try it out. Please take a look at the changes we've made in Beta and  learn more about it. Thanks for reading, and for making the site better!

Should DNA be Patentable?

Hemos posted more than 12 years ago | from the debates-of-our-time dept.

Patents 257

nexex writes: "This story seems brings the patent debate home; specifically, should a company or person be able to 'own' your DNA? Obviously researchers want to profit from their discoveries, thus funding new research. But critics counter they are profitting at the expense of our health, citing restrive screening licenses for things such as breast cancer and Alzheimer's. Citing a figure from a UK activist group, 500,000 gene or gene sequence patents have been applied for worldwide. Another excellent article on this issue from Salon.com was from a couple years ago."

cancel ×

257 comments

Sorry! There are no comments related to the filter you selected.

too late (3, Insightful)

dal3 (195148) | more than 12 years ago | (#2946351)

If someone tries to patent my DNA, shouldn't I be able to provide them with lock of hair as an example of prior art?

Re:too late (1)

buzban (227721) | more than 12 years ago | (#2946511)

indeed...this may be a very good summary of the way U.S. patent law works in reality. Prior use. ;)

Hmm... (0)

Anonymous Coward | more than 12 years ago | (#2946353)

Well, I don't want people to clone me, so I'd patent myself :)

Too late? (0)

Anonymous Coward | more than 12 years ago | (#2946357)

I am guessing that it is too late to stop this. Given the incredible number of DNA patents already granted, it will be nearly impossible to turn back the clock. The article does talk about patents of a different scope, but the cat is out of the bag. Corporations will drive and drive ahead to make this happens because it means money. Now, should you own your own DNA? Sure. And your vagina and penis too!

Re:Too late? (1)

www.sorehands.com (142825) | more than 12 years ago | (#2946674)

Though a patent is granted, it may not be enforcable. Laws could rule certain patents unenforcable. Even if you have a patent, it only is tested in court -- the PTO is not the final arbiter.


I patented sex, so you you don't pay you aren't screwed.

NO! (2, Insightful)

koekepeer (197127) | more than 12 years ago | (#2946362)

DNA should not be patentable. It would be morally wrong, since the discovery of a gene is exactly that: nothing new and unique has been created, it's just finding something that was there already.

Patents should protect new ideas, not entities that are already present in nature and are waiting to be found.

However, when you can put a piece of DNA to use in any way, the methodology your technique follows should be patentable. A new method for application of a certain DNA sequence is something that can be new and innovative.

Re:NO! (0)

Anonymous Coward | more than 12 years ago | (#2946742)

Who owns the patent for water?

Patent AIDS, Herpes, Malaria... (4, Funny)

Calle Ballz (238584) | more than 12 years ago | (#2946364)

Put a patent and a copyright on the strands that make up diseases like AIDS, Herpes, Malaria & the common cold. I'm tired of catching a cold, and I sure as hell don't want to get any terminal diseases in the near future. If you think about it, DNA is really a kind of software, it is intellectual property that's been unclaimed. Well dammit someone should claim that IP and protect it's right to not be copied unless specifically authorized by the rightful owner and in compliance with the DMCA!

Re:Patent AIDS, Herpes, Malaria... (1)

hrics (552279) | more than 12 years ago | (#2946469)

would that mean if i contracted Malaria i would then be in violation of copyright?

Re:Patent AIDS, Herpes, Malaria... (2)

Calle Ballz (238584) | more than 12 years ago | (#2946507)

No, the person or entity that allowed you to contract the disease (i.e. The person, elephant poop, tse tse fly...) would be held liable for violation of copyright and patent infringement. Your rights would be protected as that particular strain of DNA© was illegally copied onto your platform (body).

Re:Patent AIDS, Herpes, Malaria... (0)

Anonymous Coward | more than 12 years ago | (#2946598)

Actually this is quite common. There are a ton of patents issued for gene sequences derived from diseases...most issued because the products of the gene sequences elicit an immune response of some kind. If [insert big pharma here] were to discover a vaccine or therapeutic that targets the patented gene sequence, the owner of the patent would stand to profit handsomely.

Patenting of genes should only be allowed when the patent demonstrates a workable knowledge of gene function and explicit, limited claims as to the gene's application. Saying that I patent the sequence AGGTC..TCT because it might be important is too vague to be meaningful...and I have a feeling that many of the proteomics firms out there feel that the US Patent Office might feel the same way in a year or two.

Alan Thick (DNA expert) DEAD. (-1)

Alan_Thicke (553655) | more than 12 years ago | (#2946366)

I just heard the sad news on CBC radio. Comedy actor/writer Alan Thicke was found dead in his home this morning. Even if you never watched his work, you can appreciate what he did for 80's television. Truly a Canadian icon.
He will be missed :(



Show me That Smile (The Growing Pains Theme Song):

Show me that smile again.
Ooh show me that smile.
Don't waste another minute on your crying.
We're nowhere near the end.
We're nowhere near.
The best is ready to begin.

As long as we got each other
We got the world
Sitting right in our hands.
Baby rain or shine;
All the time.
We got each other
Sharing the laughter and love. [goatse.cx]

They can patent my DNA... (1)

NecroPuppy (222648) | more than 12 years ago | (#2946368)

When they take it from my cold, dead body!

Oh, wait....

first post loving? No? yes? (-1, Troll)

Anonymous Coward | more than 12 years ago | (#2946369)

FIRST POST? OR WHAT? WEENT

Depends on patent length (2, Insightful)

Kjella (173770) | more than 12 years ago | (#2946370)

I do realize medical research is a huge money sink, but depending on the disease, if you get the right patents you can get a limited monopoly in a marked where there are *no* substitute treatment, and that people can't do without (aka they would die). Those together let you set whatever price you want on your drugs/services, and people will just have to pay. Or, your medical insurance would but it'd still be passed on to us as increased premiums. On the other hand, if there's not enough money to find the cure in the first place the entire thing is pretty moot.

Kjella

Cool be neat.. (1)

Tha_Zanthrax (521419) | more than 12 years ago | (#2946372)

I don't think that the patenting op particular sequence should be possible.

It would be cool, you could sue your brother(s)/sister(s) for having their DNA look to much like yours.
Be mindfull of your parents not doing the same...

Patent Infringement (1)

CaptCanuk (245649) | more than 12 years ago | (#2946373)

Time for illegitamately born children or unwanted pregnancies to get sued by... their parents.
This all goes back to that episodoe of Superman where Lex Luthor clones Superman and Bizarro is what results. We should learn our lesson from cartoons.

Re:Patent Infringement (2)

pmc (40532) | more than 12 years ago | (#2946625)

We should learn our lesson from cartoons.

OK - you stand under the 16ton weight first then.

Flying penguins... (0)

Anonymous Coward | more than 12 years ago | (#2946380)

U.S. patent attorneys say they will have more luck trying to teach penguins to fly.

Pfft. What do they know about flying penguins.

Re:Flying penguins... (1)

The Pi-Guy (529892) | more than 12 years ago | (#2946569)

I'd agree - didn't Linus have a penguin fly at him at over 100mph?

--joshua

Patenting therapies, not the gene (5, Informative)

HEbGb (6544) | more than 12 years ago | (#2946381)

Two requirements of a patent are the existance of an 'inventive step' and another is 'novelty'.

Patenting a gene itself (if that's what's done) is nothing more than patenting a transcription of an already-existing structure. It won't hold up - there is no novelty, and no invention - you're just writing down what already exists.

However, an inventive, novel step could be the application of the knowledge contained in the gene for specific therapies which were developed. These can and are patented, and I don't see anything wrong with this.

I think there's a common misconception that these companies are patenting genes themselves-I think that with few exception, this isn't the case - they're patenting applications of the knowledge to new therapies, much like someone who has studied the physiology of the body can patent a drug to treat an illness. You're not patenting the mechanism of the body, you're patenting a tool based on that knowledge.

Re:Patenting therapies, not the gene (2)

AnalogBoy (51094) | more than 12 years ago | (#2946467)

So.. Could I patent my process of splicing firefly and baboon genes into human DNA, to make someone's butt glow technicolor-like whenever they're excited?

Re:Patenting therapies, not the gene (2, Insightful)

drcln (98574) | more than 12 years ago | (#2946517)

No one patents genes; no one patents life. These people are just silly. More precisely, the research companies are patenting a newly isolated and described chemical compound. It is also possible to patent a method for using such a chemical compound; although it is tough to get therapy patents when there is no record that the therapy usually works. You have to show that you know what to do with a chemical compound before you can patent it.

In this case, the patented chemical compound is a piece of DNA or RNA which is useful for a number of things. You can use it to detect DNA with a complementary sequnce from a patient's tissue sample. Thus, it is a research tool just as you might patent a clever electronic spectrophotometic tool. The highly indignant researcher from Penn was using a patented research tool which was very expensive to invent and perfect. Myriad and the other research companies have just as valid a right to ask to be paid for its efforts as HP or Lucent's Bell Labs.

Re:Patenting therapies, not the gene (1)

Vornzog (409419) | more than 12 years ago | (#2946645)

As the parent to this pointed out, the patent has to have an inventive step or some other novelty, or (straight from the first article), must be "novel," "nonobvious" and "utilitarian."

The idea of a gene has been around since the 1800's, thanks to one Gregor Mendel, and the knowledge of where those genes were and how they were stored has been around since ~1950, due to the work of Watson, Crick, and a few others who never get any credit. Methods to sequence the DNA has been around almost as long as we have understood what DNA was. There is nothing novel about finding a gene.

It's time to look at what patent law was originally meant to do. It was never meant to stop research and innovation - it's supposed to protect innovation by allowing people who discover something new to benefit from it. I would consider methods of treatment for genetic diseases to be fertile ground for innovation and patents galore by this standard of what is patentable.

Finding a gene is not new or nonobvious in any way. We all know the genes are there. Make the gene sequences public, but keep treatments patentable. This ensures that research and innovation are allowed to go forward, but innovations in treatment are rewarded. This is the way the system was supposed to work, and would still work if the supreme court ever stopped to think about the law they are supposed to be upholding, instead of being impressed by the big name lawyers biotech companies hire every time this ends up in court.

If the US sets an example, it will have a big impact on the international community as well. Don't hinder the research community, as their efforts will benefit the global community. Do allow patenting of treatments, so that it is still possible to profit from a good idea.

-V-

Re:Patenting therapies, not the gene (4, Insightful)

WillWare (11935) | more than 12 years ago | (#2946664)

an inventive, novel step could be the application of the knowledge contained in the gene for specific therapies which were developed. These can and are patented, and I don't see anything wrong with this

Patenting genes that occur in nature would be an obviously questionable practice, and it worries me that this issue has been kicking around unresolved for at least two years. But the thing you are describing here also worries me: it sounds like you're saying that the genetic information is properly unpatentable, but having sequenced it, I could apply for a patent controlling ANY useful application of that information. I would prefer to see patents limited to controlling a specific application of the information.

But the obviously worst-case scenario would be where any fool could operate a sequencer for a couple weeks, and patent whatever he gets, regardless of whether an application is apparent at the time of filing.

Re:Patenting therapies, not the gene (2)

Alik (81811) | more than 12 years ago | (#2946736)

What you describe is the exception, not the rule. Most patents *are* on the expressed sequence of the gene itself (or the amino acid sequence of the protein, which is informationally equivalent in most cases), not on some test kit or therapeutic regimen. The described utility is generally one that has been found through computational homology studies: you screen the gene against a database of knowns, and then declare it to have functionality equivalent to that of the closest match.

As you pointed out, there's supposed to be some novelty here. The trick is that the expressed sequence isn't how the gene exists in your body: in your body, there are unexpressed intervening sequences (comments, sort of), proteins attached to the strand at various points, and other modifications. Courts have held that since the pure expressed sequence isn't the form found in nature, it's a new compound and is patentable.

I agree that the specific applications of genetic discoveries should be patentable and patented, but that ain't what we're arguing here.

Shameless self-promotion: I wrote a primer on gene patents [amsa.org] (PDF format) for the American Medical Student Association about a year ago that goes into a lot more detail on the issue.

How can you patent something that already exists? (2, Funny)

jfrumkin (97854) | more than 12 years ago | (#2946384)

I've always been confused by this - if I tried to patent my own DNA, couldn't someone use me as an example of prior work?

jhfjhfg (-1, Offtopic)

Anonymous Coward | more than 12 years ago | (#2946392)

OHH YAH!

Patent this (-1, Offtopic)

Greg's Trolling Acct (452430) | more than 12 years ago | (#2946398)

aaaggctccatgccgcctcgactaggaaggccacctactatcatattcgt
ggccggttaggagattatgcgcggcaagtaacctacgaaaggggttct gg
tggaatcaagtcgcacttttgttaaacttaggtacatcgggtgtatct gg
cgagttgcgtgggtgtcaccgatagctcagtgtcttgacagccaacgg ga
gacagatagacgggtatagcgtaaactctcttcggttttaaatgacgc at
atgggccagagggctagtttgcagctgggatacacagatcagttgcta cc
ccaccgtccagtttagtgacgtcggctgtcaggcacagcggtgtacga gc
gtggagctactctcaacatctgctggagattctactccggccgtggta tt
atcgtggcccttttgtccaatgtcccggacattgagagatatccccgc cg
atgattggaggcgggcgaagcaataagcgacggtgccaagacctagtg ag
ccaaattgttgaactgtgaaagccagatttccgactcgtaccatactc tg
cttaggaaggtgacaacgcaaatcttcctttcggaaccgcactgagta at
acagtgccggaatacgtgcggagaatgtcgagcgctgtggatgtgcac ca
tcgaacaacgaaagggcaagtgtattgtaagggattctgacctgccgg gt
aaatagtgcgagggttgataaattttgagccagtgtacgtctaaaact gc
agcgctactcccaagtaacgtatgggctaaatagcggggtaagaacct cc
aggtctaataacgtgatgttgcagggtggcgtagaggtagacgagttt tc
ttacaccataggaggtctgaaatgtccgtctgggcaatctcatcgagt aa
acttttactgcgtcttcccctaacgtcttagacaccgcagttgggatg tc
tcagcccggccacagcactcaccccgaatggccgcacgcgtcacccct ct
tccgagtttaacttaggcgcgccagaaatcttgggctcttcttagctt aa
tcggtcggcgatcgagtattggatgcacgtaaagatcgctgtacggat ac
ctccaattcacttgtgctactccttatagctgatgttcagggcgaggt tt
cggcagcgtcacagcggtcctcaccgactcgattcctactggctcatt cg
ttctcgtgccggccgatcgtgagaaattttctacggccgtatgcagat tg

// This is the clever part to create five fingers

tctagctagcgcctaacgctaaagcctagcagtatagtaaaccttacg cc
agagacggcgttttacggatagtcgacgggagccgtttctgaggtggc tc
aacgctcgtgatctgcgcgcattaccaggctaatccatgtacgtaacg ga
aaataccctgagcccctctcacgctggatgatttctcccgagtgtgga gc
gaactatatggcacgccgcatcgctccgtgagctatctggttgtccat aa
atatacacgataaccaggattcgcatctgtggagcatggatcggcacg gc
tatgctgggcacggcagatcgattatcccccgcggccagtattgagaa gt
ggcggcggtaacgagttcgggtcagggcacttgttgcacttacctaac aa
gccactccgcgaaggaaatacggcagtataatagagagacggtcgagg cg
tgctcttataattatttttgaaggacgtcttatcgtacgtaacctcct tt
ttaggatgtaacgtcggcgcttcttttgaaccaacggaccagtatggc ct
gccaggtaatatgggcaacggccccaagattctgtagaggccagtagg aa
atgaacataccaactagaggggcgtaacgtgcaacacgttatttggac ac

// Unknown glucose-generation sequence

agaatcgattcgcgtttggactaatgcccgggcctggtatcaccactg cc
tgtttcactcactaatgcaccaattaataacgtccaggtactccgcat tc
acggggccagtgtagtacgcctgttcctgaaccaacacgtctcttggt ac

// This is clearly redundant

aaggaccacagtagtttccgttgggtgacttgccccagcatcgacatg ga
cacgccccgtgcagtctgttacttgacatggcaaccgtgttgcatgaa tc
attccgcgcctagtcttaaaaagcagatggtgtccgctcatatgaatt ga
agtgccggaacgggagggttgcacacaaggcatctcgtaacgagggat ta
tatcgtgtttctctgtgatcgttctaatccttccgatcgtccaacttc ct
aatcctgcgctctggaccctcatgaaaggggaagggccatgcagggca ga
tactctcggaaaaacggactttgtctgatgacggtgcgtcgagtacac aa
agtcaggctccaaggtggccactaataggccaatgctaggacgctgcc tc

// CTGGGA would have been a better endcap terminator here

attcgagtagtcgtcccgataaagggacgagatgtcccatagctacgt ag
tcgccctggccaggggacgttggcgctgcgtcgcgagcgctttgcact ta
ttcggaggcactccttaactgaaggccccatgcattacctatgcccct at
cggcagtcggtgatggccgcgtgcccgtgggttcggttcctgttggag tg
ccaggtaccaaagggcacatttcttgaagcgaatggagcgttgctatt ta
attgcacaattgcgtgagctcggtttcttataagtcgtgcgcagcaaa cc
ccacatacttgaatattcgtagaactttacaatttcctactttcgatt ct
agagacgtagtacgtcaatttgggcaccaaaatcagcttgagaaaaca cg
gtgtgttgaccatgtcgtgtacaaccagccggtatatgacaaactgcg gg
ccgctactttcttggtacattcctcacagatcatccagtactaggaga at
gaaaccctgcccataagaacggcttagacagcctggtaggcggtcccc tc

// Compare to monkey DNA, clearly this is similar

catatccactcgcatcatgcgcagcacattgcccagcaactggaagag ac
aggtgtgggtcttcgtactacgagaactactgaaagcaggaaggcctg gg

// Patent #41847593 here

taggtattctccacctaaactcatacaaccttggcacgagttcggttc ca
tcggggagtcgcgacgtgaacgagcgttggtagatcgtcaatcagagt tt
tgtcatttccttataatgtagctcactaggtctacggcgagaggggcc tc
cattagtctccatgtaaggcggcagtgctaatcgtcacttgacaacct ac
ccccgaacggaaaggaaacgccaaagaaatacagcttagacgcgacac at
taggagggttggttatattctgaacaccttctatcgctgggcggaaga cg
cccagccatggccttatcgtccctgtgcccctcaccgtgtggtcacca aa
agacctaggatgggttttacggtcacaaaccccggttacctccgacat ac
gatcaatcaccaagtaagcgctgagagtccgggaacatagggttgggg ca
gacttgtctacaggagacacgttaacatgaactggtgcagcaagatac ta
tttgaaaacagaacgatcgtgaacccggattccaccctcctacaatga cg
ttatgacagaggggcgatagcgtcacccgacaggtttctatagatgtt cg
agcttatatcttggtgcttcttcatatccaagcactccggcagtttgc aa
aattccacttcagcttgctacacttttactgggcgtccatgaagtcat tt
ccttgtgtggtccagatcacgctccagaaatcactgctgttcgatttt ac
tcatacgtaattatggacaatcctcgtgccgacgggtgtacgcgatgc cc
cggtgatcccgatcatatttagtggcatggtccccgaccgatacctct tc
aaaaaagatgagcggcaacaacacgcacattgccacgctcgataccta tt
ccgaaaactgagactgagagtacagtcttgaaggccgactgcctcgag ct
taagatcggcaaagctatattattctgctacctctgggaaccttctcg ac
gtacggtgacacgagtccggacttagggatagctaccacggacggggc tt
attaccgttagcgggctactctagttctattgggagatgccccccagc ct

// Inefficient but clever

ctcgaaacacgtggtccaattgctacacggtcttcgtctgacccaggg tg
cgggcaattggttaaggtgaatcaaacgggtttccgttaaaggctgaa ct
agcttccgtcgcgatgctccggcgttggatatcccataccctatgcac tc
cggtcgggtgtccttctctcacaatgagtagcaagatgggggcgtatt cc
tgtttggctaaacaataaactgagacgctcctgaacaacggaggcgta cg

// Heh!

gagtacacgtgtctgcaaacctggtacacacttcgtcggcatccatgc ca
gattcctttgtcgtattccctagagaaaccaacgagtgtttgtgcgca ac
atcacggggccattgtttacgtaatcaatgctcactcaccctgatgat tt
tccatataacgaattatccgcaactgttacagagtcgtaacagagtga gg
taacggctcagtaggtcgtgttctagccgagttgaagtccccggcttg ta
atgaaagcaggtgaataaaattgattttgtcccaaaaatttgctagag tc
agtttcatttcctagaaattgtagcaatagcttatattgccctatacg ac
ggccctatgtgttttcatctaaatggaaccgtaaggcgatcgttgtcc cg
ccgccttctcagcgggtactaagggagtggcttcattccatgactagg ct
tcaacccgtgtttggagacttctgcgttctctcgctcgacctcgctta ta
tggtctttgcgcggacattgaatctgtgccaaaaggcttttatgtctc cg

// DNA sequence is questionable here

acgtgttgaagtgtatataagttgcggaaagtgaaactattgatcaga ta
ggttcactagacaattcttttataaaatctaacacccgggagctggtg at
aaggagctattggagtttcagtgctgtatgtctaagccgtatcgttta ct
acggagctatatggtatgacccctcccgggggaggtaaatccctaata gg
aacactcgttggttcgccgcgatcaacccttctttgttctggacggat ct
atcaccgacaagcacatcaacctcccacccgaaccagagaactcccac ca
ctataaccagtctggtggcaatgtgtcgaaatcgctattcctcctatc cc
acgtctagttggtacccgtaatactaaaagaggatcgtggtagggaac ta

// A rather elegant protein generation chain

tgttttttattggacaagcgcgggtgccactagaaatagtccgtatct ga
aactactacacgcagtaaccctgccaacgtacgatactgcccattatg ta
agacctacaggctgataaccacctcggttgcaaagtccgctttgatcg gg
ggggtatcagtacgactagttgcaaacatcacctgggataacatacgt ca
taaaactgaaatcatcgcccctgtcctttgcacctgcttttcgcttga cc
cgattgtgacgaaatctgctaaactgatggctaccgttgtcgcatgag cc
tggcgaagagtcagcctatgcgttaacataacttcttacgctagcgag gg
caagagcaatggcgtgtgtcgcttagggtcaaaacaattggagctgtg ta
attgtacatattcgatgtttgcaagaaaggtctgccctttgtagttga ta
gcaacgtcccccctgagttcagcgccgaccggggcggttcccgtaatg gt

// Not known

ggtgccatcggacggcgggctatattgcaggcagtacgacctccgaga gg

// Patent #49491845 here

ggtcgatggatctgcgtacaatttcacgccccgtaaagcagccatcgt cg
aggtcatttgcgctgcctcttagtgttatatttgggtcacctcagggg cg

// Not a bad choice

ggctcttacctgtccatcccgccgtacggcgtgacgtcttcccctcgc ct
agttttcctaaattacggggttagtaaactgttggccgcataggactc ta
tgcgatcaataccacgatgctacgtggatttacataccctttagataa aa
gtgtgcacggcatagcaaatacttcaactgtaagcggcatagttctgg tt

I patent G,C,T, and A, do I win? (1)

CrazyJim0 (324487) | more than 12 years ago | (#2946454)

On and U if we can start patenting RNA.

Then if we got the codon's, I'll patent the amino acids and start/stops.

Hahahha, everyone who wants to use DNA, has to pay me royalties now!

rhetorical questions (2, Interesting)

Christopher H (25358) | more than 12 years ago | (#2946399)

next week:

* Should the Internet be shut down?

* Should Open Source be illegal?

analogy? (3, Interesting)

cowscows (103644) | more than 12 years ago | (#2946400)

If I discover a new comet, should any astronomer that wants to look at it through a telescope have to pay me royalties?

It's rediculous. And that's an example of something that doesn't effect human health (Unless the comet is going to smash into earth I guess).

I cannot see how this could be construed as anything other than choosing money over humanity. It's repulsive.

Re:analogy? (-1, Offtopic)

Anonymous Coward | more than 12 years ago | (#2946575)

Just how in the hell is this offtopic? Time to METAMODERATE!

First post.. (-1)

Anonymous Coward | more than 12 years ago | (#2946403)

Well, I have prior art with my particular set of genes so they can p**s off.

This has already been tested in Japanese courts... (-1, Offtopic)

Anonymous Coward | more than 12 years ago | (#2946407)

You can read about it here [sakura.ne.jp] . Hopefully, the outcome would be much different if it were to be tried under the American court system.

Re:This has already been tested in Japanese courts (-1, Offtopic)

Anonymous Coward | more than 12 years ago | (#2946592)

OFFTOPIC??!!@#$ What kind of crack have you moderators been smoking?

Jesus...

Please understand.. (4, Insightful)

mindstrm (20013) | more than 12 years ago | (#2946408)

They do not Patent DNA. They did not invent DNA.

THey can patent specific genes for a specific purpose.

So if they discover a gene that permits them to do something interesitng, like grow you a third arm... they can patent that.
If they discover a gene that will make you smarter... they can patent that.

They cannot patent genes until they have a use for them.

Re:Please understand.. (1)

0123456789 (467085) | more than 12 years ago | (#2946437)

I'm not sure I understand you; how, by examining human DNA can a researcher claim to have invented the gene that they discover? It was already there waiting for them.

If the researcher in question generates an entirely synthetic gene, fair enough. However, the cases in question here deal with gene discoveries in existing DNA. It's kind of like claiming that, because you've 'discovered' you can use an AOL CD as a frisbee, that you can claim a patent on CDs.

Re:Please understand.. (1)

Terry Dignon (548614) | more than 12 years ago | (#2946440)

did someone invent scientific forumulas? it doesnt matter if it's "invented", only if the person is responsible for bringing it to everyone elses attention. when they patent it, they are not going to charge you monthly because you were born with such a gene, only for operations that might occur (such as growing you a third arm). i am not for/against the whole process, i just dont think its an open and shut topic. (i hope that made at least some sense)

Re:Please understand.. (2)

Wire Tap (61370) | more than 12 years ago | (#2946479)

I hate to tell you this, but no one has patents on formulae. Do you think Newton patented his laws of motion?

I can just see it now:

Soldiers are laying seige to a castle, using a trebuchet and a dead cow.
Newton: Hey! What are you guys doing over there!
Soldiers: We are launching this cow over the castle wall to poision their well!
Newton: I forbid this! I have patent number 2098724-01282 on the law of motion you are invoking! You must stop your illegal activities now, or pay royalties.

Or, even better:

The sun starts to shine on a darkened Germany.

Einstein, shouting to the heavans: Hey! What do you think you are doing!
Sun: I'm giving light to the citizens of the world!
Einstein: You can't do that! I patented the formula the describes the motion under which light moves! Pay me my royalties!

I don't think so... Come on people... you are smarter than this.

Re:Please understand.. (2, Interesting)

Terry Dignon (548614) | more than 12 years ago | (#2946596)

the "forumula" to a medecinal, pharmaceutical (yep, i cant spell), and other products are patented although they did not "invent" these, just mix them together. =)

Re:Please understand.. (1)

iphayd (170761) | more than 12 years ago | (#2946457)

"If they discover a gene that will make you smarter... they can patent that."

But, if it's found that I contain that very gene, can I claim prior art?

If not, can they get royalties from my parents?

Not so certain (2)

dachshund (300733) | more than 12 years ago | (#2946551)

So if they discover a gene that permits them to do something interesitng, like grow you a third arm... they can patent that.

Unfortunately, very few genetic discoveries thus far enjoy the certainty-of-use you describe. Most gene patents claim a slight correlation to a certain condition (eg, people born with this gene have a 3% greater chance of developing an ulcer), etc. They are far from providing specific applications. What they represent is the protection of a costly process of discovery (ie, the ability to sequence DNA using expensive equipment) and scientific experimentation (eg, when generations of mice are bred without this gene, how do they act?)

The above process is very expensive, and some would argue that the results arrived at need to be protected, no matter how weak the actual patent claims. As far as I can see, this would be similar to early 20th century atomic researchers "patenting" the heavier elements and their isotopes along with their applications ("this patented Uranium isotope, when struck with a neutron, be made to fission...") Certainly these researchers required enormous resources to detect, isolate, and understand the elements that they were working with. That does not mean that they (or the governments and corporations they worked for) should necessarily enjoy a long-term monopoly on their discoveries simply because they were the first with the right equipment to examine natural processes.

Patents skewing research (1)

yintercept (517362) | more than 12 years ago | (#2946744)

The biggest problem I see is that the Patent process will undoubtedly end up skewing the discovery process. Companies will change their discovery and research policies to make patentable discoveries, as opposed to objective discoveries. You will also see that that companies that gear their entire research process to patents will have a big club to drive out other methods of discovery. Whenever lawyers are involved the quality of life will deteriorate.

Re:Please understand.. (5, Informative)

sam_handelman (519767) | more than 12 years ago | (#2946585)

All of what you say is, or ought to be, true.

However, Biotech companies are interpreting these patents in a very broad way, as you can see from the article.

The more sophisticated the biotech you're trying to develop is, the more burdensome these low level, frankly not-very-clever patents become.

By analogy in software, imagine how difficult it would have been to write Kazaa if quick sort, merge sort and the binary search were all patented. Supposing you needed all of them (and that bubble sort wouldn't do, but stay with me), you'd need to enter into negotations with each of three different parties who hold the patents, and get permission from each of them, before you could finish Kazaa. Now, Kazaa, even though it maps to the set of integers, is a legitimate achievement; the people who wrote it deserve protection of their coding investment. Merge Sort, while a cute idea, is NOT. There is a qualitative difference between the two.

The biotech patents that are being issued are, likewise, so basic, and generated on such an industrial scale - companies just churn them out as fast as they can - that they are begining to hamper innovation.

These biotech companies often won't enter into negotations about selling their intellectual property. They're flush with cash, by and large, and if they don't know what their property is worth, why would they sell it?

When you're trying to develop something really new and sophisticated (the biotech equivalent of a complete piece of software) you may need literally dozens of tiny processes which someone has patented. Even if none of these patents will hold up in court, the risk that not one but several parties could sue you to defend their interests - usually in different jurisdictions! - makes the legal risks of implementing such a procedure prohibitive, even if none of these patents would really stand up in court.

I have to add that Columbia university, where I am a graduate student, makes more money from patents (in particular one, rather basic, biotechnology patent) than any other University in the world, including the combined patent income of the Universities of California (my BS & BA are from UCSC). That money is what pays my stipend.

Properties of Nature (3, Insightful)

Baldrson (78598) | more than 12 years ago | (#2946413)

Properties of nature are not patentable. Specific applications of properties of nature are patentable.

Patents that attempt to cover general applicability of properties of nature are invalid and the courts that uphold such patents in error.

Speak n Spell (0)

Anonymous Coward | more than 12 years ago | (#2946416)

Use a spell checker already!

Patent my ass! (-1)

Evil Inside (552726) | more than 12 years ago | (#2946418)

Come and patent my ass!

Hey guys... (0, Offtopic)

jasamaman (221350) | more than 12 years ago | (#2946424)

I'm going to patent light. And while I'm at it the entire electromagnetic spectrum! ::Evil laugh::

Re:Hey guys... (0)

Anonymous Coward | more than 12 years ago | (#2946685)

Mod parent up. + 1 Funny.

No way, think about the patent office's record! (0, Redundant)

Anonymous Coward | more than 12 years ago | (#2946425)

Jesus, what a horrible idea. The US Patent Office's record of granting patents in the IT world shows they have NO grasp of technology, how on earth would they handle something as complex as DNA?

So what happens if you patent DNA and then a human being is produced in violation of that patent? Will this person simply be destroyed? Even if they're a baby or 10 years old, or whatever?

A patent presupposes a real discovery (1)

yggdrazil (261592) | more than 12 years ago | (#2946427)

To patent something, it is supposed to be a real discovery, not something anyone with the tools of the trade would find out anyhow.

With gene sequencing machines becoming more and more common, I don't see that DNA sequences can be called real discoveries anymore. (And probably hasn't been the last few years.) Finding DNA sequences is an almost mechanical operation which shouldn't be awarded with patents.

But then again, the patent system has become so fucked these days, who cares? The patent system has to be reinvented, and all the obvious patent squatters must pay for their sins.

Let the biotechs patent actual medicins based on genetic research, not the genes themselves, because that would be stealing.

For shame (3, Insightful)

Digitalia (127982) | more than 12 years ago | (#2946432)

I always assumed that a patent was intended to cover a new or uniquely contrived object. Were these geneticists to be patenting recombinant DNA, I would be alright. When they begin to patent DNA that they discover, it becomes a travesty of science. Not only do they have no rights to that DNA, but it impedes scientific progress. Of course, most modern geneticists aren't working for the benefit of man. Some work for their own good first and last, Monsanto, while others work for their own good first but hope to benefit civilization in the process. Even academic research is beginning to fall under the latter category. In both examples, progress is stifled by greed and gluttony.

Re:For shame (0)

Anonymous Coward | more than 12 years ago | (#2946451)

Digitalia? Is that like, Genitalia? Pax Genitalia?

Same problems with selling Drugs vs Cure (1)

CrazyJim0 (324487) | more than 12 years ago | (#2946433)

Why would a company that makes billions each year off selling AIDS drugs want to cure it?

When money wins wars, governments can't even turn the cheek to help the public good.

Then we have Microsoft, who works along the same lines as selling drugs for the benefit of the United States.

Patent DNA? Sure, fine whatever, laws are already fubar.

No (0)

Anonymous Coward | more than 12 years ago | (#2946442)

It shouldn't.

Thorny subject for more reasons than one.... (2)

Fenris2001 (210117) | more than 12 years ago | (#2946443)

The article makes the point towards the end:
"It's not just the patents themselves. It's how these patents are being enforced," said Michael Watson
Information may or may not want to be free, but it costs a lot of money to do this kind of research. Patenting gene sequences and describing their function as intellectual property offers a way to recoup the high cost of R&D.

The problem is, some (not all) biotech companies are enforcing their IP like some (not all) software companies do - sue first and ask questions later.

Now, I'm sure I'll get flamed by the Slahdot crowd that thinks everything should be "Open Source", but there are fundamental differences between computer science and genetic science.

Re:Thorny subject for more reasons than one.... (0)

Anonymous Coward | more than 12 years ago | (#2946589)

Now, I'm sure I'll get flamed by the Slahdot crowd that thinks everything should be "Open Source", but there are fundamental differences between computer science and genetic science.

Why? Isn't the purpose of science to *further* human knowledge--for *all* humans? Why should a cost be associated with *any* science?

I can answer that, but probably with a different answer than you would. The answer is: for all their protestations about R&D costs requiring the controlled dissemination of their discoveries, today's scientists are little more than whores to their capitalist masters; they are in it for the money first and the science second. It could be argued that they've *always* been that way, but the modern manifestation of this creature is singularly beholden to his corporate-state overseers.

True science, the pursuit of knowledge for its own sake, is so rare today that it might as well be German measles.

if you can't run with the big dogs, (-1)

Anonymous Coward | more than 12 years ago | (#2946453)

atc gca tga cta cta ccg tca cat cgc gcg cgc gac gat acg atc gcg cat cga tcg cgt

FP!

eeee-haa!

Re:if you can't run with the big dogs, (1)

Pastor Fluff (555255) | more than 12 years ago | (#2946496)

Did you know if you read that out loud, you'd sound like Gilbert Gottfried?

Patent my DNA? (2, Funny)

Stormshadow (41368) | more than 12 years ago | (#2946455)

Knowing my luck, one day my doctor will tell me "I'm sorry, but we just noticed the DNA for your mitochondria is patented. I've been told that the patent holder is filing under the DMCA that you've illegally been copying their intellectual property since conception and you must either cease operations immediately or remove all offending material."

*sigh*

Patents to God (1)

nesneros (214571) | more than 12 years ago | (#2946459)

Give patents for all naturally occuring DNA sequences to God. Then assume he allows free, open development on his intellectual property. If this bothers God, he can take people to court.

My position (3, Insightful)

MarkusQ (450076) | more than 12 years ago | (#2946460)

Digital information should not be patentable, period.

The space of all-possible-digital-information maps directly onto the space of integers. Asking for a patent on a chunk of digital information (DNA, object code, what have you) is the same as asking for a patent on an integer. The claim that "oh, but it's a very large integer" is specious. Patents are for inventions not facts-of-math.

Copyright is only slightly more reasonable.

-- MarkusQ

It's similar to software patents (1)

RatOmeter (468015) | more than 12 years ago | (#2946543)

You came very close to saying what I wanted to post.

I think the issue of patenting DNA is similar to that of software patents, to which I disagree. In fact, DNA *is* our software and the software of all life (as we know it). That little robosome machine that transcribes our software could be viewed as a sort of execution unit.

If someone writes a cool new app in C++, they might want to patent it (or some part of it). These days (at least in the US), they'd stand a good chance of being awarded a patent. Imagine a bio-engineer who "wrote" a cool new app in DNA, say, a cholesterol eating bacterium. Seems to me he's got a similar right to protect his intellectual property, which in my opinion, is none.

Re:My position (1)

roybadami (515249) | more than 12 years ago | (#2946568)

Digital information should not be patentable, period. ... Patents are for
inventions not facts-of-math.
But only for inventions that can't be described by means of digital media (say, text, pictures, sounds, movies)?

Oh wait, if it can be described in a patent application then it can be described by means of words and diagrams alone.

Oh dear, those are representable by means of digital media. Therefore they shouldn't be patentable.

Methinks it is your argument that is specious.

Re:My position (2)

gnovos (447128) | more than 12 years ago | (#2946703)

But only for inventions that can't be described by means of digital media (say, text, pictures, sounds, movies)?

You missed his point. He wasn't refering to inventions that can be described digitally, instead he was talking about "invertions" that consist of digital information.

Remember, it's only 17 years. (0)

Anonymous Coward | more than 12 years ago | (#2946470)


An American patent lasts only 17 years, and if you allot a good seven years or so to get the thing out of the lab, then you're looking at a useful lifetime of maybe ten years.

Copyrights, on the other hand, are really scary. Originally they were to last 75 years, but recent lobbying by the Hollywood crowd has resulted in legislation under which it is not clear that copyrights will ever expire. If DNA were copyrighted, then you'd have some real cause for complaint.

Open Source (4, Funny)

DeadBugs (546475) | more than 12 years ago | (#2946472)

I am releasing my DNA under the GPL license.

That was funny. Please mod it up. (0)

Anonymous Coward | more than 12 years ago | (#2946492)


That was funny. Please mod it up.

Re:Open Source (2)

King Of Chat (469438) | more than 12 years ago | (#2946510)

Does that mean anyone can modify it? Do you live near Yucca Mountain?

Re:Open Source (2)

Robber Baron (112304) | more than 12 years ago | (#2946536)

You mean you've sprayed it all over your keyboard...

Re:Open Source (0)

Anonymous Coward | more than 12 years ago | (#2946576)

Be careful where you aim that thing! Point it away from the screen. We don't need any more viruses propagating ;-)

Patenting quasi-randomness. (1)

beowulf_26 (512332) | more than 12 years ago | (#2946473)

How can you patent something that could concievably be created by nature? Let's say that I patent the gene for neon green eyes, and somewhere down the road, some kid in Chicago is born with a mutation that gives him neon green eyes. Is he in violation of the patent? Must his parents pay our company because his body utilizes our patented gene?

How would they collect? (1)

theKiyote (542132) | more than 12 years ago | (#2946478)

Lets say I get a gene implant by a company that makes me smarter. I pay them however much they want, and go about my way. But then, lets say I have a kid, and that kid inherites the DNA that makes him or her smart, does the company still try to collect? Lets say they do, and I refuse to pay. Its not like they can take the genes back. Or what if I have a couple of bastard kids, how would they even know that they even have the genes?

If you ask me, any step closer to patenting DNA is a step closer to the world of William Gibson with blackmarket medical shops.

--theKiyote

Legal argument for why genes are patentable (5, Informative)

TekkonKinkreet (237518) | more than 12 years ago | (#2946480)

Caveats:
a) I know nothing about genetics or law myself. I learned all this from the genetics law expert I sat next to on a plane last week.
b)The duration of the explanation was part of a flight from Salt Lake to Seattle
c) I had a first class upgrade and took full advantage of the free Heinekens. That is to say, I hope I'm remembering this right.

Goes like this. It's illegal to patent an object, right? But a sequence of DNA in addition to containing the gene you're interested in, is always full of random and irrelevant pairs. So what they want to patent is not the gene as it naturally occurs, with all the junk DNA in it, but a cleaned-up version containing only those bits which are relevant to the patent. This is not a naturally occuring sequence, and so is patentable. So to answer the fellow who says "wait, I have that gene, every cell of me is prior art," no, you don't have that exact gene, yours contains different randomness. Yes, this sounds like a legalistic dodge to me too, and the expert acknowleged the point, but there it is.

A further wrinkle is that they patent the transcriptase necessary to make the cleaned-up gene, not the gene itself, though I had a sufficient buzz by that point in the conversation that I was ready to talk about football. :)

Re:Legal argument for why genes are patentable (1)

Vornzog (409419) | more than 12 years ago | (#2946732)

An interesting argument, and probably the one that gets used in court. It has one major flaw in it, though. The sequence in question, the one with all the relevant info, does occur naturally. Not in the DNA, but in the mRNA. DNA is copied to mRNA, and the mRNA is spliced to form the cleaned up version. Using a reverse transcriptase to turn it back into DNA is cool, but not novel, and not all reverse transcriptases are patented.

The 'randomness', or introns, are not actually part of the gene, so the legalistic dodge should end up full of holes if anyone bothers to ask their friendly neighborhood biochemist or molecular biologist.

-V-

Patents on Discovery? (1, Redundant)

tshak (173364) | more than 12 years ago | (#2946482)

I am a genetic and legal laymen. So here is a "typical citizen" question: Can you patent scientific discovery?

Examples:

Could Albert Einstein patent the Theory of Relativity?

Could Galileo patent the stars he found?

How, again to a laymen, are these any different than discovering certain DNA sequences?

Open Source Human (1)

stinky wizzleteats (552063) | more than 12 years ago | (#2946498)

I think I'll release my origin code under the GPL. That'll fix 'em. At least until my kids can't get paid for working under the derivative works clause.

pdf list of current patents (1)

hambone_p (410812) | more than 12 years ago | (#2946509)

Current patent lists(in pdf)for

(hu)man [pixunlimited.co.uk]

or

mouse [pixunlimited.co.uk]

Things that belong to "MANKIND" (3, Interesting)

erroneus (253617) | more than 12 years ago | (#2946526)

I think at some point, an international summit for "Things that belong to mankind" should be held and agreed upon.

Profit at the expense of public health has always been considered "wrong." But this is generally when it's a company unwilling to keep the air, water or land clean and safe for human habitation. But in cases such as patented AIDS drugs being suppressed when a far greater good could be served?

When mankind cannot 'afford' to be healthy or to survive, there is something very BROKEN in the way we are thinking. I'm not a communist, but get real... should one person DIE simply because he can't afford to live? It's all around us and no one is willing to say I'm wrong about that. But who is willing to actually step up to the plate and actually give to mankind rather than profit from its needs?

Re:Things that belong to "MANKIND" (3, Insightful)

danheskett (178529) | more than 12 years ago | (#2946678)

The fundamental problem with arguments such as yours is that they miss a major point that motivates innovation:

The Motive for Profit (aka greed, being a meanie, etc).

Drug companies will tell you how hard it is to research, develop, implement, test, study, test, study, and finally sell a drug. It is a vastly expensive operation - usually returns on new drugs are measured over the period of 10-20 years or more.

If a drug company spends billions to create a new drug, and then that drug is approriated by third-world nations, the US government, or other governments, it often results in that drug being a net financial loss for the corporation.

Everynow and then most big companies can afford a loss - but how many losses does it take to really hurt a company?

The answer to your question is prickly: if every life-saving drug was appropriated, reproduced by some other company, and given or vastly subsidized in price, what would the net, long term effect be?

I think we are already seeing that result today. These days you see drug companies promoting heart-burn medicine, anti-allergy pills, and other "quality-of-life" drugs. Why? Because - the money - and the motive - for the next "big score" isn't there.

Whats the solution?

I have no idea. I'd say government funding except that the government is a terrible researcher and very bad at coming up with new things. I'd say government subsidizes but that doesnt make sense in third-world nations. I'd say that the corporations should simply give the drugs away but I know that it would seriously lower the chances that the next big drug would be discovered. Its a pretty bad problem.

My best guess? Keep it going kinda how it is - with maybe some government benefits for doing "The Right" thing. Right now rich nations, like the US and Canada, pay very high-prices for certain drugs. We in effect subsidize drug development and distribution for many third-world nations. Maybe we could do something like "waive your international patents and you pay no federal taxes" for the drug companies. Something, anything, to create perceived value for "doing the right thing".

A legitimate use for M$'s new licensing scheme! (1)

Beetjebrak (545819) | more than 12 years ago | (#2946537)

I'm gonna put my DNA under the same license as Windows XP! That ought to make sure nobody copies it! I wonder though.. did my parents call M$ to get their copy of me activated? And what if I decide to rigorously upgrade my hardware at some point during my lifetime? Hmm.. what if I'm just a 120-eval. copy??? Scary!

Profit (1)

AntipodesTroll (552543) | more than 12 years ago | (#2946554)

Unfortunatly, in the global drug and medical industires, money talks.

Those who wish to be granted monopolizing patents in order to extract wealth out of the rest of the world, will get what they need, as long as everything is driven by money. (It takes money to make money.)

Ethics? Pfft.

good work (1, Funny)

gTsiros (205624) | more than 12 years ago | (#2946566)

They should patent the dna genes, of course.

much like others patented the star formations in the sky to find their way home.

while you're at it, patent warm water too.

A patent is one thing... (1)

MontytheMooch (204281) | more than 12 years ago | (#2946574)

..but halting research in progress due to restrictive "licensing" of a gene is something else. According to the article:

In Philadelphia, for instance, a university stopped testing 700 anxious women a year for a genetic predisposition to breast cancer because its lab was accused of violating a biotechnology company's patents.

IMO, this is complete ignorance. The stoppage of viable, in progress scientific testing by these companies is irresponible and neglectful of the people they are supposedly tring to "help".

I don't see much of a problem in patenting a particular gene sequence, but I don't think companies should be permitted to enforce a patent until a viable cure or product of that sequencing is made available. For instance:

I patent a gene sequence that will, arguably, allow for the 100% early detection and prevention of Down's Syndrome. While modern science may already know the gene sequence involved, work continues to isolate and test, sans patent restrictions. Once a viable procedeure has been validated and accepted, then and only then should patent restrictions be allowed to come into play.

Pros:
-Current research continues without worry or stoppage.

Cons:
The researchers of these projects would receive NO recognition for their work because it would immedeately be scooped up by the patent holder upon release.

Re:A patent is one thing... (1)

davecb (6526) | more than 12 years ago | (#2946688)

MontytheMooch wrote According to the article In Philadelphia, for instance, a university stopped testing 700 anxious women a year for a genetic predisposition to breast cancer because its lab was accused of violating a biotechnology company's patents.

Ontario was approached by the same company, asking for payments for all persons tested in the province. The request was (very) publicly rejected as an improper attempt to license a scientific discovery.

Interestingly, the company didn't actually sue... so it my have only been a threat to do something that wouldn't stand up in court.

Hmm (1)

The Pi-Guy (529892) | more than 12 years ago | (#2946587)

But only the inventor could patent something. So, are we saying that only God could patent it? Adam or Eve? And what about the Atheists among us? Some cro-magnon in that case? Were cro-magnons even smart enough?

Food for thought...
--joshuapi

Do we want the products of genetic engineering? (2)

SIGFPE (97527) | more than 12 years ago | (#2946607)

Then presumably we want companies to research such techniques. But companies will only research them if they're profitable. If the product of the research is easily reverse-engineered and copied companies won't be motivated to do GE research unless they are protected by patent. So I guess the original question boils down to "Do you want the products of genetic engineering?"

Reverse engineering and breach of contract (1)

randal_hicks (447937) | more than 12 years ago | (#2946612)

Right, wrong, or morally questionable ... like most others have said, it's too late to do anything about granting these patents.

Some of these discoveries were made by studying defective material from the sick and dying... opportunistic at best. People who donated material for altruistic purposes should form a class action suit against the companies who are engaging in such restrictive contracts. In so doing, they can seek an injunction against these companies, temporarily stopping them from interfering. Any money from the suit can then be rolled into a fund for financial assistance to bring the total cost of screening down to an affordable level.

It isn't supposed to be... (2, Insightful)

ManDude (231569) | more than 12 years ago | (#2946615)

You are not allowed to patent fact, in my small understanding. For example, c^2=a^2+b^2 can not be patented, since it is taken as fact. Another more simple example is you can't patent the fact that we see the sky is blue. In the case of DNA, it too is fact. You can patent the process to finding DNA, but that should be all. Clinton opened the flood gates when he allowed the patenting of DNA. It was like opening up the west to homesteaders. All of a sudden this relm of fact could now be patented, though only a small area of it.

Some conspiracy theorists see this as a move by the US, which holds much of the capability to find DNA combinations, to try and corner the lucrative market of owning this fact. The US holds a lot of power with its patent office and most of the world regards it as the gate keeper as well as fear the Patent Office since the US holds a big stick to protect it's patent system.

The patenting of fact looks much like the DMCA when held up to the light.

patentable only if (4, Insightful)

Alien54 (180860) | more than 12 years ago | (#2946641)

DNA should be patentable only if

they can document the functionality down to the level that computer code is now

The functionality is one that is not previously existing or discovered in nature.

a unique combination of features where the majority of the code is new work. The thought here is that Ford company probably could not patent a new engine unless they owned the patents on the component parts and technologies. But there are an indefinite number of ways to build car engines.

Thus one probably could not patent a fire breathing dragon, but could patent the various implementations of the various subsystems.

patenting huge random chunks of DNA, hoping that something practical will come out of it is not the way to go.

When did the attitude of scientists change? (1)

UPi (137083) | more than 12 years ago | (#2946644)

Obviously researchers want to profit from their discoveries

Since when did scientists become so profit oriented? When the DNA was discovered it was celebrated by all as the triumph of mankind.. Now most of the genetic engineering research is done in secrecy and everyone seems to have a stake. I think it's time for an ODF (Open DNA Foundation).

Re:When did the attitude of scientists change? (2)

the eric conspiracy (20178) | more than 12 years ago | (#2946733)

Since when did scientists become so profit oriented?

Since about when people started buying technology based products. Edison I guess was the prototype.

no (1)

psyco484 (555249) | more than 12 years ago | (#2946651)

if someone patents my dna, I guess I become property of the patent holders...hmmm, sounds like slavery to me. That would suck. Well, unless you're into that sort of thing.

Easy Question. (1, Flamebait)

SubtleNuance (184325) | more than 12 years ago | (#2946661)

Should DNA be Patentable?

No.

Ok, whats the next ridiculous question...

No. (0)

Anonymous Coward | more than 12 years ago | (#2946667)

If a corporation insists it owns me (Via DNA), I will have no choice but to surrender my life by starting a revolution to utterly wipe that corporation off the face of the planet.

The only corporation which may even dare to approach owning me is my credit card company - and they are quite limited to owning my credit. They actually (Hard to believe, I know) treat me right and keep lowering my interest rate, so I'm happy with them. :P

..On the plus side, I have no doubt that any corporation trying to claim ownership of a person would be laughed handily out of courts. :) Which means I can go back to reading Slashdot and not having to worry about hearing a CEO saying, "Only our patented DNA.", and then me having to shoot said CEO in the head, while saying something along the lines of, "Dodge this." (Which is good, because I really do *not* look good in tight leather.. Not with my beer gut.)

However, there's still the ever fun idea that corporations will sue other corporations for 'curing' certain types of problems. Tell me, how many diseases might be cured by tweaking DNA? How many disorders?

Could this cure sight disorders? Oh, those are non life threatening.. So perhaps, not the best example. How about a person born with an actual life threatening disorder (Say, they were born with their head up their arse or something. ;P)..

If one profit-mongering corporation wishes to keep the genetic code for head-up-the-ass disorder a secret so they can make money off of it, yet another corporation can already treat it save for fear of lawsuit.. Should not a parent have the right to have their child born without an anal-cranial inversion?

There's been rumors that the cure for the common cold has been floating around for years - only - the owners of Tylenol/Aspirin/NyQuil/etc. don't want it out. Think of the profits they'd lose if the common cold was gone!

Profits be damned. I think it's time to push for legislation regulating the hiding of medical discoveries that could aid mankind. I think it's time to value human life more than dollars (Aids drugs/South America, anyone?)..

And though, right now, it may be the aforementioned NyQuil talking...

*raises hand* They can have my DNA when they pry it from my cold dead fingers!

Corporate logos (1)

WillWare (11935) | more than 12 years ago | (#2946692)

Obviously the end-game here is that every segment of every chromosome will become the property of some corporation, and will therefore need a logo, just like any NASCAR racer. So the really meaty question before us becomes apparent.

How do you put a corporate logo on a chromosome?

You can't paint DNA. You need something that replicates along with the normal process of cell division. Rationally designed junk DNA could perhaps force chromosomes to fold into the shapes of corporate logos. DNA is pretty monochromatic under a microscope, so perhaps junk DNA could bind to little molecule thingies hanging off the double-helix that give color to the logos.

This, gentlemen, is the compelling question of our age, upon which future generations will judge us.

Implications (1)

LinuxOnHal (315199) | more than 12 years ago | (#2946719)

This could have far reaching implications that we may not see. What if I have children? Do I have to pay a licensing fee because they would contain my DNA? What if they have children? Is this a violation of the patent? How far can this go?

You thought they were your kids! (1)

Martigan80 (305400) | more than 12 years ago | (#2946726)

So all those poor parents that can't have kids and opt for the invetro will really have more money to pay if a said hospital owns the right to any strand of the DNA. Think about it-the fertilization happens in the said hospital, baby is "grown" for lack a simplicity, and they _OWN_ the baby, for it's whole life.

Maybe I'm think too far out, but it is possible. Remeber IBM thought Bill Gates was a sucker, and Bill Gates thought Open source could never be a threat.

For a more detailed explanation... (3, Informative)

Alik (81811) | more than 12 years ago | (#2946753)

There's a primer on gene patents [amsa.org] (PDF file) that I wrote about a year ago. It explains the generally-accepted patent criteria and how genetic material has been interpreted to meet those criteria. The arguments for and against patentability of genes are presented, although the bias is against strict patentability; my personal viewpoint is that applications of genetic information are fair game, but the raw sequence itself should be off-limits.
Load More Comments
Slashdot Login

Need an Account?

Forgot your password?

Submission Text Formatting Tips

We support a small subset of HTML, namely these tags:

  • b
  • i
  • p
  • br
  • a
  • ol
  • ul
  • li
  • dl
  • dt
  • dd
  • em
  • strong
  • tt
  • blockquote
  • div
  • quote
  • ecode

"ecode" can be used for code snippets, for example:

<ecode>    while(1) { do_something(); } </ecode>