
Welcome to the Slashdot Beta site -- learn more here. Use the link in the footer or click here to return to the Classic version of Slashdot.

Thank you!

Before you choose to head back to the Classic look of the site, we'd appreciate it if you share your thoughts on the Beta; your feedback is what drives our ongoing development.

Beta is different and we value you taking the time to try it out. Please take a look at the changes we've made in Beta and  learn more about it. Thanks for reading, and for making the site better!

Build Your Own Virus

michael posted more than 12 years ago | from the just-like-sea-monkeys dept.

Science 381

Wire Tap writes "Scientists have assembled the first synthetic virus. The US researchers built the infectious agent from scratch using the genome sequence for polio. The most amusing part is this snippit: 'To construct the virus, the researchers say they followed a recipe they downloaded from the internet and used gene sequences from a mail-order supplier.' Heck, don't we all have our own mail-order suppliers for gene sequences?"

Sorry! There are no comments related to the filter you selected.

fp i get it (-1)

Pen1s Goat Guy (535580) | more than 12 years ago | (#3868194)


Re:fp i get it (-1, Offtopic)

Anonymous Coward | more than 12 years ago | (#3868207)

Karma whores have no right to claim first post. AC iN dA HiZoUsE!

Re:fp i get it (-1)

handybundler (232934) | more than 12 years ago | (#3868243)

Whoaaa! [] .

Re:fp i get it (-1)

Mode0x13 (550144) | more than 12 years ago | (#3868330)

TrollTech version 2.0.14 (Crapola) running on i286-dosbox Entering postlevel: -1 TrollTech version 2.0.14 (Crapola) running on i286-dosbox Entering postlevel: -1 probing OK BSD is dying... OK Mounting Natalie Portman... OK nportman: Covered in hot grits nportman: naked and petrified Slashdot losers: found slashdot: 10 stories on front page slashdot: 5 linux FUD articles slashdot: 2 feebleminded rants slashdot: 2 recycled articles slashdot: 1 junk science story slashdot: this is not news for nerds, stuff that matters. Registering troll personalitires... Wintroll 3.0 (c) 1998 Redmond Right Wing Troll: found. Loaded at 0x1950 Jon Katz (c) VA Linux Welcome to TrollTech. HTH. HAND. C:>TROLLTEK> CD SLASHDOT C:>TROLLTEK\SLASHDOT> DEL *.* []

Re:fp i get it (-1)

Mode0x13 (550144) | more than 12 years ago | (#3868346)

I do it wrong:

TrollTech version 2.0.14 (Crapola) running on i286-dosbox

Entering postlevel: -1
TrollTech version 2.0.14 (Crapola) running on i286-dosbox

Entering postlevel: -1
probing OK
BSD is dying... OK
Mounting Natalie Portman... OK
nportman: Covered in hot grits
nportman: naked and petrified

Slashdot losers: found
slashdot: 10 stories on front page
slashdot: 5 linux FUD articles
slashdot: 2 feebleminded rants
slashdot: 2 recycled articles
slashdot: 1 junk science story
slashdot: this is not news for nerds, stuff that matters.

Registering troll personalitires...
Wintroll 3.0 (c) 1998 Redmond
Right Wing Troll: found. Loaded at 0x1950
Jon Katz (c) VA Linux

Welcome to TrollTech. HTH. HAND.


<A HREF="dfgdfgdfg"></A>

Smell my feet (-1, Offtopic)

Anonymous Coward | more than 12 years ago | (#3868197)

Give me something good to eat.

fp (-1, Troll)

Anonymous Coward | more than 12 years ago | (#3868200)

I claim this for all trollkind!

Re:fp (-1)

TrollBurger (575126) | more than 12 years ago | (#3868215)

You sir, are an embarrassment to trolls everywhere. Sorry.

But will it infect Microsoft? (-1, Troll)

Anonymous Coward | more than 12 years ago | (#3868201)

If not, it's not a real virus anyway.

Re:But will it infect Microsoft? (-1, Flamebait)

Anonymous Coward | more than 12 years ago | (#3868356)

LMFAO, tard.

No more DeCSS for me (1, Flamebait)

Henry V .009 (518000) | more than 12 years ago | (#3868203)

I've posted an aerosol AIDS virus recipe to my website [] . Go there and check it out.

Sure it's a joke now, but just wait a few years...

Re:No more DeCSS for me (0, Funny)

Mode0x13 (550144) | more than 12 years ago | (#3868300)

TrollTech version 2.0.14 (Crapola) running on i286-dosbox

Entering postlevel: -1
probing OK
BSD is dying... OK
Mounting Natalie Portman... OK
nportman: Covered in hot grits
nportman: naked and petrified

Slashdot losers: found
slashdot: 10 stories on front page
slashdot: 5 linux FUD articles
slashdot: 2 feebleminded rants
slashdot: 2 recycled articles
slashdot: 1 junk science story
slashdot: this is not news for nerds, stuff that matters.

Registering troll personalitires...
Wintroll 3.0 (c) 1998 Redmond
Right Wing Troll: found. Loaded at 0x1950
Jon Katz (c) VA Linux

Welcome to TrollTech. HTH. HAND.



Re:No more DeCSS for me (-1, Troll)

Anonymous Coward | more than 12 years ago | (#3868316)

last poster: has too much time to create stupid fake programs

Re:No more DeCSS for me (-1, Troll)

Anonymous Coward | more than 12 years ago | (#3868370)


Re:No more DeCSS for me (-1)

Horny Smurf (590916) | more than 12 years ago | (#3868351)

I should have known better than to dare my friend Kara at anything. Least of all, something as totally depraved and raunchy as a snowball....
It was early summer, still early enough to not be intolerable, but hot and sticky enough that both our sundresses were clinging to our well-defined
bodies, in a fine sweat. Kara had made pink lemonade, and we were in a picnic spot sipping away. Then, out of the blue, she asks me, "have you ever tried a snowball?" I nearly spit out my drink. Kara has never been one to mince words, but nevertheless I hadn't been expecting that.

"Well? Have you?" Kara was waiting expectantly for my answer.

"! Yeeeeeck! That's disgusting!" But my smile belied my curiosity and excitement.

"Why disgusting?" my friend demanded. "Don't tell me you've never had a guy cum in your mouth before!"

I couldn't tell her that....I'd had hundreds--quite a few of them with Kara present and sucking and fucking whomever she'd brought home for the night.

Instead, I said, "No...I mean....kissing another girl after...."

Kara only smiled evilly. I thought back to the time she'd walked into the bedroom and caught me masturbating on my bed. Nothing too embarrassing
about that....except for the matter of exactly what I'd been fantasizing about as I frigged my sopping wet cunt. To this day I couldn't be entirely
sure if she'd heard me calling out her name, as my fingers drove me to orgasm after beautiful orgasm....but if she had been anywhere in the
apartment during the few minutes leading up to her catching me in the act, I couldn't see how she could have missed hearing it even if a jet plane were flying overhead!

Smiling, Kara asked me, "Does that mean you'd never kiss another woman? Even if she had a mouth full of delicious jism?"

"Never," I lied. "And even if I did....I'd never find someone who would do something that obscene."

"Hmmmm," Kara mused, running her finger along her bottom lip. "I might be prone to try something like that...."

"YOU?" I exclaimed, shocked. "You'd never do something like that."

"Dare me," Kara challenged.

"OK....I dare you!" I giggled, playing along.

Then Kara shocked the hell out of me by standing up and heading straight over to two guys who were playing catch with a football.

"Kara!" I hissed. "Hey...what...GET BACK HERE!" She looked back at me as if to say "you should know not to dare me..."

As she stood there, speaking with the two guys and flirting heavily (even from my vantage point, I could now distinctly see bulges in their shorts), I
wished I could melt into the nearby trees. Even more so as she turned and began walking back toward me, holding hands with each of the guys. I felt so
embarrassed! My face must have been bright red as Kara brought the two guys over.

She introduced me. "This is my friend, Terri." Maybe it was just my imagination, but I could have sworn she had put an odd emphasis on the word
"friend". "Terri, this is.....ummmm...these...." Inspiration struck. "These are hard cocks for us to enjoy!" Not surprisingly, neither of the young guys
objected to being classified as a walking sex object.

Kara had the guys sit on the picnic bench, and she quickly got both of them out of their shorts as i watched, a bit shocked at my friend's boldness. She
guided me in front of the first guy, who was taller of the two and sandy-haired, gently but firmly pushing me to my knees in front of him.

"Terri, here, is gonna take good care of you. But," she warned, "you have to cum in my mouth. I need both of you to cum in my mouth."
Then Kara took her own place in front of the other guy and began giving his hard prick a tongue bath. Then, I felt a hand on the back of my head, as my
guy gently pulled me toward him. I opened wide and took him in...

We knelt there in our sundresses, our knees getting dirty as we slurped away at these magnificent hard cocks. Kara popped her man's meat out of her mouth
for a moment, to murmur to the sandy-haired guy, "let me show you what my 'friend' likes..." She led me to the top of the picnic table where she
arranged me on my back, slipping my sundress down so that it was bunched around my waist, my 36-D braless tits now fully exposed. Then she started
playing with them! My nipples immediately got rock hard.

"Doesn't she have nice big firm titties?" Kara cooed. Sandy-haired muttered his agreement. "She just loooooooves having a hard cock between
them and having them fucked," she whispered.

Sandy didn't need to be told twice. He quickly straddled my chest and plopped his meat between my boobs, and I pushed them together for him.
I stuck my tongue out as far as it would go, licking the tip of his cock every time it poked through my cleavage. As I got titty-fucked, I glanced over at Kara and was surprised to see her getting wildly fucked from behind!

Kara was all talk. "Come on, you hot cocks...I need your cum....I need it in my mouth....give it to me!" She directed me as well. "Terri... push those
nice juicy tits together...tighter! Make him cum....!"

Kara's man announced that he was going to cum. He pulled out of her and turned around, taking a sitting position on top of the picnic table as her
guy stood on the bench. Grabbing his shaft, she hastily jerked him off. With a gasp, he let go and fired spurt after spurt of his sticky cum into Kara's mouth. This proved to be too much for the fellow balling my breasts, who also announced that he was about to cum.

Kara grabbed his cock and pulled him toward her open mouth, and he situated himself standing on the bench next to his friend. The only problem was that
his friend wasn't quite done filling Kara's mouth with his seed, and the first two spurts of sandy's cum went all over her cheek and in her hair.
Then as the other man stepped aside, she opened her already cum-drenched mouth to take the rest of it.
Finally the well was dry. But Kara's fun was just beginning. She opened her mouth to show me the treasure we'd harvested together; the white sticky jism was literally overflowing over her teeth and lips and dripping down her chin.

Then she drew me in and our lips locked.....

What seemed like a gallon of hot, sticky, creamy sperm gushed into my mouth. I swished the salty cream around my mouth then passed it back to
her....then back to me again. this time, her tongue followed, and as our tongues met, I had the first of many orgasms for that afternoon.....

Re:No more DeCSS for me (-1, Offtopic)

Anonymous Coward | more than 12 years ago | (#3868395)

Why did you create an aerosol AIDS virus? I'm not judging you or anything. I'm just wondering what was going through you head when you were thinking this up.

Are you trying do develop simulations of possible mutations in order to save life much unneeded suffering?


Not surprising, unfortunately (2, Interesting)

h2oliu (38090) | more than 12 years ago | (#3868206)

I remember my BioChem classes (10+ years ago), and it seemed even back then that to some degree the technology was already there. It does make you wonder if this is truly the first one, or just the first one to be formally announced.

Re:Not surprising, unfortunately (-1)

Horny Smurf (590916) | more than 12 years ago | (#3868363)

This should surprise you!

I should have known better than to dare my friend Kara at anything. Least of all, something as totally depraved and raunchy as a snowball....
It was early summer, still early enough to not be intolerable, but hot and sticky enough that both our sundresses were clinging to our well-defined
bodies, in a fine sweat. Kara had made pink lemonade, and we were in a picnic spot sipping away. Then, out of the blue, she asks me, "have you ever tried a snowball?" I nearly spit out my drink. Kara has never been one to mince words, but nevertheless I hadn't been expecting that.

"Well? Have you?" Kara was waiting expectantly for my answer.

"! Yeeeeeck! That's disgusting!" But my smile belied my curiosity and excitement.

"Why disgusting?" my friend demanded. "Don't tell me you've never had a guy cum in your mouth before!"

I couldn't tell her that....I'd had hundreds--quite a few of them with Kara present and sucking and fucking whomever she'd brought home for the night.

Instead, I said, "No...I mean....kissing another girl after...."

Kara only smiled evilly. I thought back to the time she'd walked into the bedroom and caught me masturbating on my bed. Nothing too embarrassing
about that....except for the matter of exactly what I'd been fantasizing about as I frigged my sopping wet cunt. To this day I couldn't be entirely
sure if she'd heard me calling out her name, as my fingers drove me to orgasm after beautiful orgasm....but if she had been anywhere in the
apartment during the few minutes leading up to her catching me in the act, I couldn't see how she could have missed hearing it even if a jet plane were flying overhead!

Smiling, Kara asked me, "Does that mean you'd never kiss another woman? Even if she had a mouth full of delicious jism?"

"Never," I lied. "And even if I did....I'd never find someone who would do something that obscene."

"Hmmmm," Kara mused, running her finger along her bottom lip. "I might be prone to try something like that...."

"YOU?" I exclaimed, shocked. "You'd never do something like that."

"Dare me," Kara challenged.

"OK....I dare you!" I giggled, playing along.

Then Kara shocked the hell out of me by standing up and heading straight over to two guys who were playing catch with a football.

"Kara!" I hissed. "Hey...what...GET BACK HERE!" She looked back at me as if to say "you should know not to dare me..."

As she stood there, speaking with the two guys and flirting heavily (even from my vantage point, I could now distinctly see bulges in their shorts), I
wished I could melt into the nearby trees. Even more so as she turned and began walking back toward me, holding hands with each of the guys. I felt so
embarrassed! My face must have been bright red as Kara brought the two guys over.

She introduced me. "This is my friend, Terri." Maybe it was just my imagination, but I could have sworn she had put an odd emphasis on the word
"friend". "Terri, this is.....ummmm...these...." Inspiration struck. "These are hard cocks for us to enjoy!" Not surprisingly, neither of the young guys
objected to being classified as a walking sex object.

Kara had the guys sit on the picnic bench, and she quickly got both of them out of their shorts as i watched, a bit shocked at my friend's boldness. She
guided me in front of the first guy, who was taller of the two and sandy-haired, gently but firmly pushing me to my knees in front of him.

"Terri, here, is gonna take good care of you. But," she warned, "you have to cum in my mouth. I need both of you to cum in my mouth."
Then Kara took her own place in front of the other guy and began giving his hard prick a tongue bath. Then, I felt a hand on the back of my head, as my
guy gently pulled me toward him. I opened wide and took him in...

We knelt there in our sundresses, our knees getting dirty as we slurped away at these magnificent hard cocks. Kara popped her man's meat out of her mouth
for a moment, to murmur to the sandy-haired guy, "let me show you what my 'friend' likes..." She led me to the top of the picnic table where she
arranged me on my back, slipping my sundress down so that it was bunched around my waist, my 36-D braless tits now fully exposed. Then she started
playing with them! My nipples immediately got rock hard.

"Doesn't she have nice big firm titties?" Kara cooed. Sandy-haired muttered his agreement. "She just loooooooves having a hard cock between
them and having them fucked," she whispered.

Sandy didn't need to be told twice. He quickly straddled my chest and plopped his meat between my boobs, and I pushed them together for him.
I stuck my tongue out as far as it would go, licking the tip of his cock every time it poked through my cleavage. As I got titty-fucked, I glanced over at Kara and was surprised to see her getting wildly fucked from behind!

Kara was all talk. "Come on, you hot cocks...I need your cum....I need it in my mouth....give it to me!" She directed me as well. "Terri... push those
nice juicy tits together...tighter! Make him cum....!"

Kara's man announced that he was going to cum. He pulled out of her and turned around, taking a sitting position on top of the picnic table as her
guy stood on the bench. Grabbing his shaft, she hastily jerked him off. With a gasp, he let go and fired spurt after spurt of his sticky cum into Kara's mouth. This proved to be too much for the fellow balling my breasts, who also announced that he was about to cum.

Kara grabbed his cock and pulled him toward her open mouth, and he situated himself standing on the bench next to his friend. The only problem was that
his friend wasn't quite done filling Kara's mouth with his seed, and the first two spurts of sandy's cum went all over her cheek and in her hair.
Then as the other man stepped aside, she opened her already cum-drenched mouth to take the rest of it.
Finally the well was dry. But Kara's fun was just beginning. She opened her mouth to show me the treasure we'd harvested together; the white sticky jism was literally overflowing over her teeth and lips and dripping down her chin.

Then she drew me in and our lips locked.....

What seemed like a gallon of hot, sticky, creamy sperm gushed into my mouth. I swished the salty cream around my mouth then passed it back to
her....then back to me again. this time, her tongue followed, and as our tongues met, I had the first of many orgasms for that afternoon.....

Re:Not surprising, unfortunately (0)

stuuf (587464) | more than 12 years ago | (#3868402)

So its true what my bio teacher said about being able to call up a biological supplier and say "I want a DNA molecule that goes ATTCGACAGATTGCTAGCTGAGTCCGAGTCGCCTATGACTCGA"

You'd Better Watch Out (0)

DonkeyHote (521235) | more than 12 years ago | (#3868210)

With all the terrorist paranoia going on in the U.S., you might just get arrested for a stunt like this.

Re:You'd Better Watch Out (0)

Anonymous Coward | more than 12 years ago | (#3868258)

With all the terrorist paranoia going on in the U.S., you might just get arrested for a stunt like this.

And rightfully so. Just imagine what Armani or Gilgamesh would do if they had access to one of these virus creation kits.

Get an Amiga, and quit worrying about viruses! (-1, Offtopic)

Anonymous Coward | more than 12 years ago | (#3868213)


Re:Get an Amiga, and quit worrying about viruses! (-1, Offtopic)

Anonymous Coward | more than 12 years ago | (#3868269)

Amiga FO'EVA, bee-yotches!

I can see the popular media now... (0)

Anonymous Coward | more than 12 years ago | (#3868216)

Al-Quda set to infect US via the Internet with a virus downloaded from mail order sources. CNN on Monday?

Huge medicine possibility (2, Interesting)

tuxrules (227341) | more than 12 years ago | (#3868223)

What if, say, a virus could be designed to destroy cancer cells? What if a virus could be designed to infect parasites? If the drug companies start doing this, it's only a matter of time before they can make viruses that can target disease cells extraordinarily effectively.

Re:Huge medicine possibility (2, Insightful)

gerf (532474) | more than 12 years ago | (#3868247)

True, just like there were a couple computer viruses that searched out and destroyed the bad ones.

of course, this wouldn't work. viruses can't attack each other.

perhaps we can make viruses to attack bacteria strains? but this is too questionable. what if you make a strain that kills off good bacteria that we need? no, too risky. kinda like the bacteria that eat petroleum, and could make it into some underground reservoir. just too dangerous

so what good could these virii do for us? safely, not much. there's too many things that go wrong with simple chemicals we use in regular drugs, much less a biochemical virus, which is much more complicated than anything we can wholley, fully, and correctly predict

Re:Huge medicine possibility (2)

Henry V .009 (518000) | more than 12 years ago | (#3868270)

There have actually been studies on animals and even humans using genetically engineered viruses (not made from scratch) to do this kind of thing for years. They keep killing people though, so I don't know that they're having as much success as they'd like.

Re:Huge medicine possibility (2, Insightful)

neuroticia (557805) | more than 12 years ago | (#3868312)

Early blood transfusions would kill people, as well. Seems like most medical technologies kill people in the early stages. The researchers just need to get it right. (Early blood transfusions killed people due to cross-species transfusions, and lack of knowledge of blood types.)

Of course, this will open up a whole can of worms, too, I'm sure. Renegade viruses that we can't stop, etc.

Sometimes I just have to wonder which innovation of humanity will kill us all off. =]


Re:Huge medicine possibility (3, Funny)

Subcarrier (262294) | more than 12 years ago | (#3868360)


Oooh, verdamnt, not once more! Back to ze dravink board es ist. Igor, clear out ze body and vasche ze beakerz! Schnell! Ich must vork on the formula some more! Hunh...

Re:Huge medicine possibility (0)

Anonymous Coward | more than 12 years ago | (#3868368)

I do not know what studies to which you are referring. But there are promising and so far successful approaches: ri l10/cold.html

Re:Huge medicine possibility (-1)

Horny Smurf (590916) | more than 12 years ago | (#3868410)

I should have known better than to dare my friend Kara at anything. Least of all, something as totally depraved and raunchy as a snowball....
It was early summer, still early enough to not be intolerable, but hot and sticky enough that both our sundresses were clinging to our well-defined
bodies, in a fine sweat. Kara had made pink lemonade, and we were in a picnic spot sipping away. Then, out of the blue, she asks me, "have you ever tried a snowball?" I nearly spit out my drink. Kara has never been one to mince words, but nevertheless I hadn't been expecting that.

"Well? Have you?" Kara was waiting expectantly for my answer.

"! Yeeeeeck! That's disgusting!" But my smile belied my curiosity and excitement.

"Why disgusting?" my friend demanded. "Don't tell me you've never had a guy cum in your mouth before!"

I couldn't tell her that....I'd had hundreds--quite a few of them with Kara present and sucking and fucking whomever she'd brought home for the night.

Instead, I said, "No...I mean....kissing another girl after...."

Kara only smiled evilly. I thought back to the time she'd walked into the bedroom and caught me masturbating on my bed. Nothing too embarrassing
about that....except for the matter of exactly what I'd been fantasizing about as I frigged my sopping wet cunt. To this day I couldn't be entirely
sure if she'd heard me calling out her name, as my fingers drove me to orgasm after beautiful orgasm....but if she had been anywhere in the
apartment during the few minutes leading up to her catching me in the act, I couldn't see how she could have missed hearing it even if a jet plane were flying overhead!

Smiling, Kara asked me, "Does that mean you'd never kiss another woman? Even if she had a mouth full of delicious jism?"

"Never," I lied. "And even if I did....I'd never find someone who would do something that obscene."

"Hmmmm," Kara mused, running her finger along her bottom lip. "I might be prone to try something like that...."

"YOU?" I exclaimed, shocked. "You'd never do something like that."

"Dare me," Kara challenged.

"OK....I dare you!" I giggled, playing along.

Then Kara shocked the hell out of me by standing up and heading straight over to two guys who were playing catch with a football.

"Kara!" I hissed. "Hey...what...GET BACK HERE!" She looked back at me as if to say "you should know not to dare me..."

As she stood there, speaking with the two guys and flirting heavily (even from my vantage point, I could now distinctly see bulges in their shorts), I
wished I could melt into the nearby trees. Even more so as she turned and began walking back toward me, holding hands with each of the guys. I felt so
embarrassed! My face must have been bright red as Kara brought the two guys over.

She introduced me. "This is my friend, Terri." Maybe it was just my imagination, but I could have sworn she had put an odd emphasis on the word
"friend". "Terri, this is.....ummmm...these...." Inspiration struck. "These are hard cocks for us to enjoy!" Not surprisingly, neither of the young guys
objected to being classified as a walking sex object.

Kara had the guys sit on the picnic bench, and she quickly got both of them out of their shorts as i watched, a bit shocked at my friend's boldness. She
guided me in front of the first guy, who was taller of the two and sandy-haired, gently but firmly pushing me to my knees in front of him.

"Terri, here, is gonna take good care of you. But," she warned, "you have to cum in my mouth. I need both of you to cum in my mouth."
Then Kara took her own place in front of the other guy and began giving his hard prick a tongue bath. Then, I felt a hand on the back of my head, as my
guy gently pulled me toward him. I opened wide and took him in...

We knelt there in our sundresses, our knees getting dirty as we slurped away at these magnificent hard cocks. Kara popped her man's meat out of her mouth
for a moment, to murmur to the sandy-haired guy, "let me show you what my 'friend' likes..." She led me to the top of the picnic table where she
arranged me on my back, slipping my sundress down so that it was bunched around my waist, my 36-D braless tits now fully exposed. Then she started
playing with them! My nipples immediately got rock hard.

"Doesn't she have nice big firm titties?" Kara cooed. Sandy-haired muttered his agreement. "She just loooooooves having a hard cock between
them and having them fucked," she whispered.

Sandy didn't need to be told twice. He quickly straddled my chest and plopped his meat between my boobs, and I pushed them together for him.
I stuck my tongue out as far as it would go, licking the tip of his cock every time it poked through my cleavage. As I got titty-fucked, I glanced over at Kara and was surprised to see her getting wildly fucked from behind!

Kara was all talk. "Come on, you hot cocks...I need your cum....I need it in my mouth....give it to me!" She directed me as well. "Terri... push those
nice juicy tits together...tighter! Make him cum....!"

Kara's man announced that he was going to cum. He pulled out of her and turned around, taking a sitting position on top of the picnic table as her
guy stood on the bench. Grabbing his shaft, she hastily jerked him off. With a gasp, he let go and fired spurt after spurt of his sticky cum into Kara's mouth. This proved to be too much for the fellow balling my breasts, who also announced that he was about to cum.

Kara grabbed his cock and pulled him toward her open mouth, and he situated himself standing on the bench next to his friend. The only problem was that
his friend wasn't quite done filling Kara's mouth with his seed, and the first two spurts of sandy's cum went all over her cheek and in her hair.
Then as the other man stepped aside, she opened her already cum-drenched mouth to take the rest of it.
Finally the well was dry. But Kara's fun was just beginning. She opened her mouth to show me the treasure we'd harvested together; the white sticky jism was literally overflowing over her teeth and lips and dripping down her chin.

Then she drew me in and our lips locked.....

What seemed like a gallon of hot, sticky, creamy sperm gushed into my mouth. I swished the salty cream around my mouth then passed it back to
her....then back to me again. this time, her tongue followed, and as our tongues met, I had the first of many orgasms for that afternoon.....

Re:Huge medicine possibility (3, Interesting)

Sheetrock (152993) | more than 12 years ago | (#3868364)

Viruses have already been employed in gene therapy, and actually this technique was involved in the first gene-therapy death. So, already been done and already wreaked unforseen havoc on at least one occasion, but the idea is that the virus alters the genes in a person's cells in a beneficial manner rather than in a way that causes the cells to churn out more viruses.

Re:Huge medicine possibility (3, Insightful)

einhverfr (238914) | more than 12 years ago | (#3868272)

What if, say, a virus could be designed to destroy cancer cells?

Until they mutate and we have that same viruses destroying healthy tissue. Besides, what would the immune response be? Would that make you sick?

Re:Huge medicine possibility (-1)

Horny Smurf (590916) | more than 12 years ago | (#3868338)

I should have known better than to dare my friend Kara at anything. Least of all, something as totally depraved and raunchy as a snowball....
It was early summer, still early enough to not be intolerable, but hot and sticky enough that both our sundresses were clinging to our well-defined
bodies, in a fine sweat. Kara had made pink lemonade, and we were in a picnic spot sipping away. Then, out of the blue, she asks me, "have you ever tried a snowball?" I nearly spit out my drink. Kara has never been one to mince words, but nevertheless I hadn't been expecting that.

"Well? Have you?" Kara was waiting expectantly for my answer.

"! Yeeeeeck! That's disgusting!" But my smile belied my curiosity and excitement.

"Why disgusting?" my friend demanded. "Don't tell me you've never had a guy cum in your mouth before!"

I couldn't tell her that....I'd had hundreds--quite a few of them with Kara present and sucking and fucking whomever she'd brought home for the night.

Instead, I said, "No...I mean....kissing another girl after...."

Kara only smiled evilly. I thought back to the time she'd walked into the bedroom and caught me masturbating on my bed. Nothing too embarrassing
about that....except for the matter of exactly what I'd been fantasizing about as I frigged my sopping wet cunt. To this day I couldn't be entirely
sure if she'd heard me calling out her name, as my fingers drove me to orgasm after beautiful orgasm....but if she had been anywhere in the
apartment during the few minutes leading up to her catching me in the act, I couldn't see how she could have missed hearing it even if a jet plane were flying overhead!

Smiling, Kara asked me, "Does that mean you'd never kiss another woman? Even if she had a mouth full of delicious jism?"

"Never," I lied. "And even if I did....I'd never find someone who would do something that obscene."

"Hmmmm," Kara mused, running her finger along her bottom lip. "I might be prone to try something like that...."

"YOU?" I exclaimed, shocked. "You'd never do something like that."

"Dare me," Kara challenged.

"OK....I dare you!" I giggled, playing along.

Then Kara shocked the hell out of me by standing up and heading straight over to two guys who were playing catch with a football.

"Kara!" I hissed. "Hey...what...GET BACK HERE!" She looked back at me as if to say "you should know not to dare me..."

As she stood there, speaking with the two guys and flirting heavily (even from my vantage point, I could now distinctly see bulges in their shorts), I
wished I could melt into the nearby trees. Even more so as she turned and began walking back toward me, holding hands with each of the guys. I felt so
embarrassed! My face must have been bright red as Kara brought the two guys over.

She introduced me. "This is my friend, Terri." Maybe it was just my imagination, but I could have sworn she had put an odd emphasis on the word
"friend". "Terri, this is.....ummmm...these...." Inspiration struck. "These are hard cocks for us to enjoy!" Not surprisingly, neither of the young guys
objected to being classified as a walking sex object.

Kara had the guys sit on the picnic bench, and she quickly got both of them out of their shorts as i watched, a bit shocked at my friend's boldness. She
guided me in front of the first guy, who was taller of the two and sandy-haired, gently but firmly pushing me to my knees in front of him.

"Terri, here, is gonna take good care of you. But," she warned, "you have to cum in my mouth. I need both of you to cum in my mouth."
Then Kara took her own place in front of the other guy and began giving his hard prick a tongue bath. Then, I felt a hand on the back of my head, as my
guy gently pulled me toward him. I opened wide and took him in...

We knelt there in our sundresses, our knees getting dirty as we slurped away at these magnificent hard cocks. Kara popped her man's meat out of her mouth
for a moment, to murmur to the sandy-haired guy, "let me show you what my 'friend' likes..." She led me to the top of the picnic table where she
arranged me on my back, slipping my sundress down so that it was bunched around my waist, my 36-D braless tits now fully exposed. Then she started
playing with them! My nipples immediately got rock hard.

"Doesn't she have nice big firm titties?" Kara cooed. Sandy-haired muttered his agreement. "She just loooooooves having a hard cock between
them and having them fucked," she whispered.

Sandy didn't need to be told twice. He quickly straddled my chest and plopped his meat between my boobs, and I pushed them together for him.
I stuck my tongue out as far as it would go, licking the tip of his cock every time it poked through my cleavage. As I got titty-fucked, I glanced over at Kara and was surprised to see her getting wildly fucked from behind!

Kara was all talk. "Come on, you hot cocks...I need your cum....I need it in my mouth....give it to me!" She directed me as well. "Terri... push those
nice juicy tits together...tighter! Make him cum....!"

Kara's man announced that he was going to cum. He pulled out of her and turned around, taking a sitting position on top of the picnic table as her
guy stood on the bench. Grabbing his shaft, she hastily jerked him off. With a gasp, he let go and fired spurt after spurt of his sticky cum into Kara's mouth. This proved to be too much for the fellow balling my breasts, who also announced that he was about to cum.

Kara grabbed his cock and pulled him toward her open mouth, and he situated himself standing on the bench next to his friend. The only problem was that
his friend wasn't quite done filling Kara's mouth with his seed, and the first two spurts of sandy's cum went all over her cheek and in her hair.
Then as the other man stepped aside, she opened her already cum-drenched mouth to take the rest of it.
Finally the well was dry. But Kara's fun was just beginning. She opened her mouth to show me the treasure we'd harvested together; the white sticky jism was literally overflowing over her teeth and lips and dripping down her chin.

Then she drew me in and our lips locked.....

What seemed like a gallon of hot, sticky, creamy sperm gushed into my mouth. I swished the salty cream around my mouth then passed it back to
her....then back to me again. this time, her tongue followed, and as our tongues met, I had the first of many orgasms for that afternoon.....

Re:Huge medicine possibility (1)

gotak (547354) | more than 12 years ago | (#3868341)

Immune respond would be a legitimate question. But we do have immune supression drugs. Better to been slightly weak for a while then to die from cancer.

Mutation would occure only if the engineered virus is allowed to reproduce. IF it's just a means to target certain cell it's a once off deal once used it's gone.

Of course there are alot of questions. But this is the way to do it's just like surgery only at a very small scale.

Re:Huge medicine possibility (5, Informative)

krmt (91422) | more than 12 years ago | (#3868391)

This is a possiblity, but pretty much anyone who's serious about this (ie, actually doing work in the field) is using a virus that can't replicate on its own. It just doesn't have the machinery to do so, because we've taken it out all together. Believe it or not, the space in a viral genome is very valuable, and you want to make as much use of it as you can, so you take out everything that's not necessary to your work.

So if the virus mutates (which isn't likely, given that most mutations happen during genomic replication) it would just sit there, doing nothing. I suppose that potentially another, wild-type virus could coinfect the cell with the mutant (also relatively unlikely) and supplement the necessary machinery, but this is no more likely than if the wild type virus itself had mutated, in which case you have a new strain on your hands (although with the originally synthetic mutant, it would still need to be supplemented by the wild type each time it infected a cell in order to replicate).

While you do raise a good point about mutation, it's not any different than what happens in nature. In fact, it's probably far more controllable.

Re:Huge medicine possibility (5, Interesting)

krmt (91422) | more than 12 years ago | (#3868359)

What if, say, a virus could be designed to destroy cancer cells?
Heh. This is exactly what my lab is doing, as are many others. We're using a modified adenovirus to deliver a suicide gene to cancer cells, thereby killing them. Not a new idea anymore at all (people have been working on gene therapy for over a decade) but it's one that takes a lot of time to put in motion. Just do a search on "gene therapy" and "viral vector" at PubMed [] and you'll get more info than you ever wanted to know about what's going on.

Re:Huge medicine possibility (5, Funny)

nick357 (108909) | more than 12 years ago | (#3868405)

"I may not have morals, but I have standards."

When someone who is in the business of "using a modified adenovirus to deliver a suicide gene", is using a sig like this, it scares the bejeebers out of me...

Finally! (5, Funny)

Joe Tie. (567096) | more than 12 years ago | (#3868225)

From the article: injected it into mice to demonstrate that it was active. The animals were paralysed and then died.

After decades of research, advances in biotechnology finally creates the long fabled "better mousetrap".

Re:Finally! (0)

Anonymous Coward | more than 12 years ago | (#3868294)

Yeap, scientics running after mice, and injecting 'em.
I'll stick with my cat ta.

Re:Finally! (-1)

Horny Smurf (590916) | more than 12 years ago | (#3868378)

I should have known better than to dare my friend Kara at anything. Least of all, something as totally depraved and raunchy as a snowball....
It was early summer, still early enough to not be intolerable, but hot and sticky enough that both our sundresses were clinging to our well-defined
bodies, in a fine sweat. Kara had made pink lemonade, and we were in a picnic spot sipping away. Then, out of the blue, she asks me, "have you ever tried a snowball?" I nearly spit out my drink. Kara has never been one to mince words, but nevertheless I hadn't been expecting that.

"Well? Have you?" Kara was waiting expectantly for my answer.

"! Yeeeeeck! That's disgusting!" But my smile belied my curiosity and excitement.

"Why disgusting?" my friend demanded. "Don't tell me you've never had a guy cum in your mouth before!"

I couldn't tell her that....I'd had hundreds--quite a few of them with Kara present and sucking and fucking whomever she'd brought home for the night.

Instead, I said, "No...I mean....kissing another girl after...."

Kara only smiled evilly. I thought back to the time she'd walked into the bedroom and caught me masturbating on my bed. Nothing too embarrassing
about that....except for the matter of exactly what I'd been fantasizing about as I frigged my sopping wet cunt. To this day I couldn't be entirely
sure if she'd heard me calling out her name, as my fingers drove me to orgasm after beautiful orgasm....but if she had been anywhere in the
apartment during the few minutes leading up to her catching me in the act, I couldn't see how she could have missed hearing it even if a jet plane were flying overhead!

Smiling, Kara asked me, "Does that mean you'd never kiss another woman? Even if she had a mouth full of delicious jism?"

"Never," I lied. "And even if I did....I'd never find someone who would do something that obscene."

"Hmmmm," Kara mused, running her finger along her bottom lip. "I might be prone to try something like that...."

"YOU?" I exclaimed, shocked. "You'd never do something like that."

"Dare me," Kara challenged.

"OK....I dare you!" I giggled, playing along.

Then Kara shocked the hell out of me by standing up and heading straight over to two guys who were playing catch with a football.

"Kara!" I hissed. "Hey...what...GET BACK HERE!" She looked back at me as if to say "you should know not to dare me..."

As she stood there, speaking with the two guys and flirting heavily (even from my vantage point, I could now distinctly see bulges in their shorts), I
wished I could melt into the nearby trees. Even more so as she turned and began walking back toward me, holding hands with each of the guys. I felt so
embarrassed! My face must have been bright red as Kara brought the two guys over.

She introduced me. "This is my friend, Terri." Maybe it was just my imagination, but I could have sworn she had put an odd emphasis on the word
"friend". "Terri, this is.....ummmm...these...." Inspiration struck. "These are hard cocks for us to enjoy!" Not surprisingly, neither of the young guys
objected to being classified as a walking sex object.

Kara had the guys sit on the picnic bench, and she quickly got both of them out of their shorts as i watched, a bit shocked at my friend's boldness. She
guided me in front of the first guy, who was taller of the two and sandy-haired, gently but firmly pushing me to my knees in front of him.

"Terri, here, is gonna take good care of you. But," she warned, "you have to cum in my mouth. I need both of you to cum in my mouth."
Then Kara took her own place in front of the other guy and began giving his hard prick a tongue bath. Then, I felt a hand on the back of my head, as my
guy gently pulled me toward him. I opened wide and took him in...

We knelt there in our sundresses, our knees getting dirty as we slurped away at these magnificent hard cocks. Kara popped her man's meat out of her mouth
for a moment, to murmur to the sandy-haired guy, "let me show you what my 'friend' likes..." She led me to the top of the picnic table where she
arranged me on my back, slipping my sundress down so that it was bunched around my waist, my 36-D braless tits now fully exposed. Then she started
playing with them! My nipples immediately got rock hard.

"Doesn't she have nice big firm titties?" Kara cooed. Sandy-haired muttered his agreement. "She just loooooooves having a hard cock between
them and having them fucked," she whispered.

Sandy didn't need to be told twice. He quickly straddled my chest and plopped his meat between my boobs, and I pushed them together for him.
I stuck my tongue out as far as it would go, licking the tip of his cock every time it poked through my cleavage. As I got titty-fucked, I glanced over at Kara and was surprised to see her getting wildly fucked from behind!

Kara was all talk. "Come on, you hot cocks...I need your cum....I need it in my mouth....give it to me!" She directed me as well. "Terri... push those
nice juicy tits together...tighter! Make him cum....!"

Kara's man announced that he was going to cum. He pulled out of her and turned around, taking a sitting position on top of the picnic table as her
guy stood on the bench. Grabbing his shaft, she hastily jerked him off. With a gasp, he let go and fired spurt after spurt of his sticky cum into Kara's mouth. This proved to be too much for the fellow balling my breasts, who also announced that he was about to cum.

Kara grabbed his cock and pulled him toward her open mouth, and he situated himself standing on the bench next to his friend. The only problem was that
his friend wasn't quite done filling Kara's mouth with his seed, and the first two spurts of sandy's cum went all over her cheek and in her hair.
Then as the other man stepped aside, she opened her already cum-drenched mouth to take the rest of it.
Finally the well was dry. But Kara's fun was just beginning. She opened her mouth to show me the treasure we'd harvested together; the white sticky jism was literally overflowing over her teeth and lips and dripping down her chin.

Then she drew me in and our lips locked.....

What seemed like a gallon of hot, sticky, creamy sperm gushed into my mouth. I swished the salty cream around my mouth then passed it back to
her....then back to me again. this time, her tongue followed, and as our tongues met, I had the first of many orgasms for that afternoon.....

Worrisome? (5, Insightful)

maynard-lag (235813) | more than 12 years ago | (#3868231)

Ok, wtf, from the article we have these snippets:

Responding to criticisms that such research could lead to bioterrorists engineering new lethal viruses, the scientists behind the experiment said that only a few people had the knowledge to make it happen.

and then the rest of the article is filled with stuff like this?!

To construct the virus, the researchers say they followed a recipe they downloaded from the internet and used gene sequences from a mail-order supplier.

According to researcher Jeronimo Cello, the polio virus assembled in the laboratory is one of the simplest known viruses. "It was very easy to do," he said.

"We've known this could be done. We've known it was just a matter of time before it was done," he said.

Why shouldn't we be worried?

Re:Worrisome? (2, Insightful)

billstr78 (535271) | more than 12 years ago | (#3868246)

I also hope that this sort of synthesized virus does not become another "Africanized Bee".

A new virus?! (5, Funny)

Schmelter (563031) | more than 12 years ago | (#3868233)

Great, another computer-engineered virus.

No wonder my roomate has been screaming "I send you this file in order to have your advice. See you later. Thanks. " while throwing porn at me and defacing my website. Fortunately, I was able to powercycle him with a car-battery.

Re:A new virus?! (-1)

Horny Smurf (590916) | more than 12 years ago | (#3868384)

I should have known better than to dare my friend Kara at anything. Least of all, something as totally depraved and raunchy as a snowball....
It was early summer, still early enough to not be intolerable, but hot and sticky enough that both our sundresses were clinging to our well-defined
bodies, in a fine sweat. Kara had made pink lemonade, and we were in a picnic spot sipping away. Then, out of the blue, she asks me, "have you ever tried a snowball?" I nearly spit out my drink. Kara has never been one to mince words, but nevertheless I hadn't been expecting that.

"Well? Have you?" Kara was waiting expectantly for my answer.

"! Yeeeeeck! That's disgusting!" But my smile belied my curiosity and excitement.

"Why disgusting?" my friend demanded. "Don't tell me you've never had a guy cum in your mouth before!"

I couldn't tell her that....I'd had hundreds--quite a few of them with Kara present and sucking and fucking whomever she'd brought home for the night.

Instead, I said, "No...I mean....kissing another girl after...."

Kara only smiled evilly. I thought back to the time she'd walked into the bedroom and caught me masturbating on my bed. Nothing too embarrassing
about that....except for the matter of exactly what I'd been fantasizing about as I frigged my sopping wet cunt. To this day I couldn't be entirely
sure if she'd heard me calling out her name, as my fingers drove me to orgasm after beautiful orgasm....but if she had been anywhere in the
apartment during the few minutes leading up to her catching me in the act, I couldn't see how she could have missed hearing it even if a jet plane were flying overhead!

Smiling, Kara asked me, "Does that mean you'd never kiss another woman? Even if she had a mouth full of delicious jism?"

"Never," I lied. "And even if I did....I'd never find someone who would do something that obscene."

"Hmmmm," Kara mused, running her finger along her bottom lip. "I might be prone to try something like that...."

"YOU?" I exclaimed, shocked. "You'd never do something like that."

"Dare me," Kara challenged.

"OK....I dare you!" I giggled, playing along.

Then Kara shocked the hell out of me by standing up and heading straight over to two guys who were playing catch with a football.

"Kara!" I hissed. "Hey...what...GET BACK HERE!" She looked back at me as if to say "you should know not to dare me..."

As she stood there, speaking with the two guys and flirting heavily (even from my vantage point, I could now distinctly see bulges in their shorts), I
wished I could melt into the nearby trees. Even more so as she turned and began walking back toward me, holding hands with each of the guys. I felt so
embarrassed! My face must have been bright red as Kara brought the two guys over.

She introduced me. "This is my friend, Terri." Maybe it was just my imagination, but I could have sworn she had put an odd emphasis on the word
"friend". "Terri, this is.....ummmm...these...." Inspiration struck. "These are hard cocks for us to enjoy!" Not surprisingly, neither of the young guys
objected to being classified as a walking sex object.

Kara had the guys sit on the picnic bench, and she quickly got both of them out of their shorts as i watched, a bit shocked at my friend's boldness. She
guided me in front of the first guy, who was taller of the two and sandy-haired, gently but firmly pushing me to my knees in front of him.

"Terri, here, is gonna take good care of you. But," she warned, "you have to cum in my mouth. I need both of you to cum in my mouth."
Then Kara took her own place in front of the other guy and began giving his hard prick a tongue bath. Then, I felt a hand on the back of my head, as my
guy gently pulled me toward him. I opened wide and took him in...

We knelt there in our sundresses, our knees getting dirty as we slurped away at these magnificent hard cocks. Kara popped her man's meat out of her mouth
for a moment, to murmur to the sandy-haired guy, "let me show you what my 'friend' likes..." She led me to the top of the picnic table where she
arranged me on my back, slipping my sundress down so that it was bunched around my waist, my 36-D braless tits now fully exposed. Then she started
playing with them! My nipples immediately got rock hard.

"Doesn't she have nice big firm titties?" Kara cooed. Sandy-haired muttered his agreement. "She just loooooooves having a hard cock between
them and having them fucked," she whispered.

Sandy didn't need to be told twice. He quickly straddled my chest and plopped his meat between my boobs, and I pushed them together for him.
I stuck my tongue out as far as it would go, licking the tip of his cock every time it poked through my cleavage. As I got titty-fucked, I glanced over at Kara and was surprised to see her getting wildly fucked from behind!

Kara was all talk. "Come on, you hot cocks...I need your cum....I need it in my mouth....give it to me!" She directed me as well. "Terri... push those
nice juicy tits together...tighter! Make him cum....!"

Kara's man announced that he was going to cum. He pulled out of her and turned around, taking a sitting position on top of the picnic table as her
guy stood on the bench. Grabbing his shaft, she hastily jerked him off. With a gasp, he let go and fired spurt after spurt of his sticky cum into Kara's mouth. This proved to be too much for the fellow balling my breasts, who also announced that he was about to cum.

Kara grabbed his cock and pulled him toward her open mouth, and he situated himself standing on the bench next to his friend. The only problem was that
his friend wasn't quite done filling Kara's mouth with his seed, and the first two spurts of sandy's cum went all over her cheek and in her hair.
Then as the other man stepped aside, she opened her already cum-drenched mouth to take the rest of it.
Finally the well was dry. But Kara's fun was just beginning. She opened her mouth to show me the treasure we'd harvested together; the white sticky jism was literally overflowing over her teeth and lips and dripping down her chin.

Then she drew me in and our lips locked.....

What seemed like a gallon of hot, sticky, creamy sperm gushed into my mouth. I swished the salty cream around my mouth then passed it back to
her....then back to me again. this time, her tongue followed, and as our tongues met, I had the first of many orgasms for that afternoon.....

Why FreeBSD is dying by poopbot (-1, Offtopic)

Anonymous Coward | more than 12 years ago | (#3868235)

The End of FreeBSD

[ed. note: in the following text, former FreeBSD developer Mike Smith gives his reasons for abandoning FreeBSD]

When I stood for election to the FreeBSD core team nearly two years ago, many of you will recall that it was after a long series of debates during which I maintained that too much organisation, too many rules and too much formality would be a bad thing for the project.

Today, as I read the latest discussions on the future of the FreeBSD project, I see the same problem; a few new faces and many of the old going over the same tired arguments and suggesting variations on the same worthless schemes. Frankly I'm sick of it.

FreeBSD used to be fun. It used to be about doing things the right way. It used to be something that you could sink your teeth into when the mundane chores of programming for a living got you down. It was something cool and exciting; a way to spend your spare time on an endeavour you loved that was at the same time wholesome and worthwhile.

It's not anymore. It's about bylaws and committees and reports and milestones, telling others what to do and doing what you're told. It's about who can rant the longest or shout the loudest or mislead the most people into a bloc in order to legitimise doing what they think is best. Individuals notwithstanding, the project as a whole has lost track of where it's going, and has instead become obsessed with process and mechanics.

So I'm leaving core. I don't want to feel like I should be "doing something" about a project that has lost interest in having something done for it. I don't have the energy to fight what has clearly become a losing battle; I have a life to live and a job to keep, and I won't achieve any of the goals I personally consider worthwhile if I remain obligated to care for the project.


I'm sure that I've offended some people already; I'm sure that by the time I'm done here, I'll have offended more. If you feel a need to play to the crowd in your replies rather than make a sincere effort to address the problems I'm discussing here, please do us the courtesy of playing your politics openly.

From a technical perspective, the project faces a set of challenges that significantly outstrips our ability to deliver. Some of the resources that we need to address these challenges are tied up in the fruitless metadiscussions that have raged since we made the mistake of electing officers. Others have left in disgust, or been driven out by the culture of abuse and distraction that has grown up since then. More may well remain available to recruitment, but while the project is busy infighting our chances for successful outreach are sorely diminished.

There's no simple solution to this. For the project to move forward, one or the other of the warring philosophies must win out; either the project returns to its laid-back roots and gets on with the work, or it transforms into a super-organised engineering project and executes a brilliant plan to deliver what, ultimately, we all know we want.

Whatever path is chosen, whatever balance is struck, the choosing and the striking are the important parts. The current indecision and endless conflict are incompatible with any sort of progress.

Trying to dissect the above is far beyond the scope of any parting shot, no matter how distended. All I can really ask of you all is to let go of the minutiae for a moment and take a look at the big picture. What is the ultimate goal here? How can we get there with as little overhead as possible? How would you like to be treated by your fellow travellers?


To the Slashdot "BSD is dying" crowd - big deal. Death is part of the cycle; take a look at your soft, pallid bodies and consider that right this very moment, parts of you are dying. See? It's not so bad.

To the bulk of the FreeBSD committerbase and the developer community at large - keep your eyes on the real goals. It's when you get distracted by the politickers that they sideline you. The tireless work that you perform keeping the system clean and building is what provides the platform for the obsessives and the prima donnas to have their moments in the sun. In the end, we need you all; in order to go forwards we must first avoid going backwards.

To the paranoid conspiracy theorists - yes, I work for Apple too. No, my resignation wasn't on Steve's direct orders, or in any way related to work I'm doing, may do, may not do, or indeed what was in the tea I had at lunchtime today. It's about real problems that the project faces, real problems that the project has brought upon itself. You can't escape them by inventing excuses about outside influence, the problem stems from within.

To the politically obsessed - give it a break, if you can. No, the project isn't a lemonade stand anymore, but it's not a world-spanning corporate juggernaut either and some of the more grandiose visions going around are in need of a solid dose of reality. Keep it simple, stupid.

To the grandstanders, the prima donnas, and anyone that thinks that they can hold the project to ransom for their own agenda - give it a break, if you can. When the current core were elected, we took a conscious stand against vigorous sanctions, and some of you have exploited that. A new core is going to have to decide whether to repeat this mistake or get tough. I hope they learn from our errors.


I started work on FreeBSD because it was fun. If I'm going to continue, it has to be fun again. There are things I still feel obligated to do, and with any luck I'll find the time to meet those obligations.

However I don't feel an obligation to get involved in the political mess the project is in right now. I tried, I burnt out. I don't feel that my efforts were worthwhile. So I won't be standing for election, I won't be shouting from the sidelines, and I probably won't vote in the next round of ballots.

You could say I'm packing up my toys. I'm not going home just yet, but I'm not going to play unless you can work out how to make the project somewhere fun to be again.

= Mike


To announce that there must be no criticism of the president, or that we are to stand by the president, right or wrong, is not only unpatriotic and servile, but is morally treasonable to the American public. -- Theodore Roosevelt

- poopbot: crapflooding since 7/8/02

heh (-1, Flamebait)

Anonymous Coward | more than 12 years ago | (#3868236)

slashdot crew

unable to recognize idiocy
unable to recognize sarcasm

nothing new here

Oh great... (4, Funny)

Anonymous Coward | more than 12 years ago | (#3868237)

Damn script kiddies designing their own viruses, how long until they get their own downloadable virus construction toolkit?

What's it called?


kewl! I just made 5m4L7p0x

Release it dude!

Bush Animals (-1, Troll)

Anonymous Coward | more than 12 years ago | (#3868238)

This is Bu$hit money. Can't kill bin Laden but make a virus it's OK. lol.

Hi there biology! (0)

Anonymous Coward | more than 12 years ago | (#3868240)

Here in computer science, we've mastered the technique years ago. Nowadays even kids can write their own computer viruses. Top that.

"there is nothing that can be done" (1)

Mad Quacker (3327) | more than 12 years ago | (#3868249)

"Dr Peters said he was concerned that publicity about a synthesized virus might lead some people to believe "that there is nothing that can be done about bioterrorism - which is not the case"".

True but it may be never that we do the something to stop it. Technology brings power to people, in the end all that matters is if a person or a group has sufficient motivation to do something. As long as you have policies that enable people to _want_ to kill you, you will have people killing you in any way they can, call it terrorism or whatever you want.

But these ideas have already been put forth many years ago, it's called the "Prime Directive". Too bad all people look to sci/fi for these days are lasers, aliens, and explosions.

genetics not rocket science (0)

Anonymous Coward | more than 12 years ago | (#3868257)

I know several undergrad biology majors who routinely do things with genes that I would have thought only high level researchers got to do.

Turns out, genetic engineering isn't all that complicated.

Re:rocket science not genetics (0)

Anonymous Coward | more than 12 years ago | (#3868385)

I know several undergrad physics majors who routinely do things with rockets that I would have thought only high level researchers got to do. Turns out, rocket science isn't all that complicated.

Re:genetics not rocket science (1)

gnarled (411192) | more than 12 years ago | (#3868416)

In biology in my freshman year of high school we transformed normal E. Coli bacteria into a type that glow, of course we got the special glowing gene packages from a university's lab but still....

Is this really such a good idea? (1)

jjv411 (267377) | more than 12 years ago | (#3868259)

Cloning sheep is one thing, but does anyone else think that sythesizing virii is a really, really, really bad idea? Didn't anyone read (or see) "the Stand." This idea is about as good as all those AI software gurus who must not have seen Terminator. Come on people!!! Is this really a good idea? How about splicing together a cure for AIDS instead of a mutant death virus?

Re:Is this really such a good idea? (0)

Anonymous Coward | more than 12 years ago | (#3868282)

Because if you discover a cure against the AIDS, you can sell one thing. In the other hand, if you make a virus, you can sell it to terrorists and the antidote to the masses.
Think Different, Think Bu$h

Re:Is this really such a good idea? (3, Insightful)

krmt (91422) | more than 12 years ago | (#3868345)

What if the cure for AIDS is a synthetic virus of some kind?

A virus makes a good gene delivery vector, and the ability to synthesize one isn't really so much different than modifying the hell out of existing ones, which we've been doing for decades now. Hell, I'm working on doing that right now in my lab in order to help treat cancer.

Try to think of this as another powerful tool. It's a tool that can be used to help and hurt, but it all depends on the person using it.

Re:Is this really such a good idea? (5, Insightful)

CheechBG (247105) | more than 12 years ago | (#3868398)

OK, so let me get this straight. Your idea is to completely stifle scientific progress and research because of a James Cameron movie and a moderately interesting (IMO) Stephen King book? Great, why don't we stop putting prosthesi on people with no limbs, didn't you see Star Wars? They'll all eventually turn into Vader!

Granted, I am ALL about taking care of the problam at hand before someone goes off on a tangent and builds a polio virus for shits and giggles, but your argument could use a little work.

linux sux! (-1, Troll)

Anonymous Coward | more than 12 years ago | (#3868261)

linux is a peice of shit. fuck linux!

Re:linux sux! (-1, Offtopic)

Anonymous Coward | more than 12 years ago | (#3868265)

Because you don't have skills to use it?

Re:linux sux! (-1, Offtopic)

Anonymous Coward | more than 12 years ago | (#3868275)

no, its a pita to use, lacks standards, BSD FOREVER!

Re:linux sux! (0)

Anonymous Coward | more than 12 years ago | (#3868303)

BSD it's OK for server side only IMHO.
Linux it's great as desktop and server too.
BSD is going nowhere.

Re:linux sux! (-1, Troll)

Anonymous Coward | more than 12 years ago | (#3868319)

MS-DOS 6.22 R|_|13Z!!!1!!


The Sky Lords (1)

J23SE (107309) | more than 12 years ago | (#3868280)

This reminds me of an interesting SF book I read a while back, where the world of the future was dramatically altered by genetic engineering, in not so great ways. In the sky lords, humans were fighting a losing battle against genetically engineered designer viruses, plagues, and fungi. Fungus had covered most of the earth's farmable terrain, and the remnants of humanity were left scattered and alone, vulnerable to terrorism by marauding overlords who had gained possession of giant dirigibles constructed from materials from space, pretty much the only thing that could run (using solar power) since.. viruses had consumed all of the perishable resources of the earth. Heheh, pretty freaky, eh?

Makes me think that the world has far less to fear from nuclear weapons than from technology like this.

Great book. It has cool ideas, corporation bashing, a really freaky, badass character who wields a katana, and it's fun.

Check it out if you're bored!

"Gene Wars" (1)

adagioforstrings (192285) | more than 12 years ago | (#3868287)

This article reminded me of a short story I read once called "Gene Wars" by Paul J. McAuley. It's an interesting little tale of a child who grows up playing with biokits such as "Splicing Your Own Semisentients" and the sort of future one could make as a genetic engineer...of sorts. Creating viruses to infect other people, modifying your own immune system to combat it. Kind of frightening, really. Check it out--I've got a copy of it in "The Year's Best Science Fiction Ninth Annual Collection." I don't know where else it's published.

conspiracy theory (1, Troll)

edrugtrader (442064) | more than 12 years ago | (#3868291)

i have always believed HIV was engineered... it just seems so perfect of a virus. the way Herpes 'hides' in the spinal cord is also ingenious and leaves a lot of suspicsion.

the government has been making these viruses for years to destroy certain populations. just wait until they decide computer hackers need to go, and a new virus is created that is only trasmitted by keyboard cheese!

Re:conspiracy theory (1)

undeg chwech (589211) | more than 12 years ago | (#3868342)

Herpes was known at least as long ago as 1900 [] so I doubt it was engineered.

Re:conspiracy theory (0)

Anonymous Coward | more than 12 years ago | (#3868348)


No you don't. That site is down again!! :(

How much bandwidth do you use? I might be able to help, perhaps.

What are you worried about? You sell drugs... (0)

Anonymous Coward | more than 12 years ago | (#3868374)

...on the Internet.

Re:conspiracy theory (-1)

Horny Smurf (590916) | more than 12 years ago | (#3868399)

I should have known better than to dare my friend Kara at anything. Least of all, something as totally depraved and raunchy as a snowball....
It was early summer, still early enough to not be intolerable, but hot and sticky enough that both our sundresses were clinging to our well-defined
bodies, in a fine sweat. Kara had made pink lemonade, and we were in a picnic spot sipping away. Then, out of the blue, she asks me, "have you ever tried a snowball?" I nearly spit out my drink. Kara has never been one to mince words, but nevertheless I hadn't been expecting that.

"Well? Have you?" Kara was waiting expectantly for my answer.

"! Yeeeeeck! That's disgusting!" But my smile belied my curiosity and excitement.

"Why disgusting?" my friend demanded. "Don't tell me you've never had a guy cum in your mouth before!"

I couldn't tell her that....I'd had hundreds--quite a few of them with Kara present and sucking and fucking whomever she'd brought home for the night.

Instead, I said, "No...I mean....kissing another girl after...."

Kara only smiled evilly. I thought back to the time she'd walked into the bedroom and caught me masturbating on my bed. Nothing too embarrassing
about that....except for the matter of exactly what I'd been fantasizing about as I frigged my sopping wet cunt. To this day I couldn't be entirely
sure if she'd heard me calling out her name, as my fingers drove me to orgasm after beautiful orgasm....but if she had been anywhere in the
apartment during the few minutes leading up to her catching me in the act, I couldn't see how she could have missed hearing it even if a jet plane were flying overhead!

Smiling, Kara asked me, "Does that mean you'd never kiss another woman? Even if she had a mouth full of delicious jism?"

"Never," I lied. "And even if I did....I'd never find someone who would do something that obscene."

"Hmmmm," Kara mused, running her finger along her bottom lip. "I might be prone to try something like that...."

"YOU?" I exclaimed, shocked. "You'd never do something like that."

"Dare me," Kara challenged.

"OK....I dare you!" I giggled, playing along.

Then Kara shocked the hell out of me by standing up and heading straight over to two guys who were playing catch with a football.

"Kara!" I hissed. "Hey...what...GET BACK HERE!" She looked back at me as if to say "you should know not to dare me..."

As she stood there, speaking with the two guys and flirting heavily (even from my vantage point, I could now distinctly see bulges in their shorts), I
wished I could melt into the nearby trees. Even more so as she turned and began walking back toward me, holding hands with each of the guys. I felt so
embarrassed! My face must have been bright red as Kara brought the two guys over.

She introduced me. "This is my friend, Terri." Maybe it was just my imagination, but I could have sworn she had put an odd emphasis on the word
"friend". "Terri, this is.....ummmm...these...." Inspiration struck. "These are hard cocks for us to enjoy!" Not surprisingly, neither of the young guys
objected to being classified as a walking sex object.

Kara had the guys sit on the picnic bench, and she quickly got both of them out of their shorts as i watched, a bit shocked at my friend's boldness. She
guided me in front of the first guy, who was taller of the two and sandy-haired, gently but firmly pushing me to my knees in front of him.

"Terri, here, is gonna take good care of you. But," she warned, "you have to cum in my mouth. I need both of you to cum in my mouth."
Then Kara took her own place in front of the other guy and began giving his hard prick a tongue bath. Then, I felt a hand on the back of my head, as my
guy gently pulled me toward him. I opened wide and took him in...

We knelt there in our sundresses, our knees getting dirty as we slurped away at these magnificent hard cocks. Kara popped her man's meat out of her mouth
for a moment, to murmur to the sandy-haired guy, "let me show you what my 'friend' likes..." She led me to the top of the picnic table where she
arranged me on my back, slipping my sundress down so that it was bunched around my waist, my 36-D braless tits now fully exposed. Then she started
playing with them! My nipples immediately got rock hard.

"Doesn't she have nice big firm titties?" Kara cooed. Sandy-haired muttered his agreement. "She just loooooooves having a hard cock between
them and having them fucked," she whispered.

Sandy didn't need to be told twice. He quickly straddled my chest and plopped his meat between my boobs, and I pushed them together for him.
I stuck my tongue out as far as it would go, licking the tip of his cock every time it poked through my cleavage. As I got titty-fucked, I glanced over at Kara and was surprised to see her getting wildly fucked from behind!

Kara was all talk. "Come on, you hot cocks...I need your cum....I need it in my mouth....give it to me!" She directed me as well. "Terri... push those
nice juicy tits together...tighter! Make him cum....!"

Kara's man announced that he was going to cum. He pulled out of her and turned around, taking a sitting position on top of the picnic table as her
guy stood on the bench. Grabbing his shaft, she hastily jerked him off. With a gasp, he let go and fired spurt after spurt of his sticky cum into Kara's mouth. This proved to be too much for the fellow balling my breasts, who also announced that he was about to cum.

Kara grabbed his cock and pulled him toward her open mouth, and he situated himself standing on the bench next to his friend. The only problem was that
his friend wasn't quite done filling Kara's mouth with his seed, and the first two spurts of sandy's cum went all over her cheek and in her hair.
Then as the other man stepped aside, she opened her already cum-drenched mouth to take the rest of it.
Finally the well was dry. But Kara's fun was just beginning. She opened her mouth to show me the treasure we'd harvested together; the white sticky jism was literally overflowing over her teeth and lips and dripping down her chin.

Then she drew me in and our lips locked.....

What seemed like a gallon of hot, sticky, creamy sperm gushed into my mouth. I swished the salty cream around my mouth then passed it back to
her....then back to me again. this time, her tongue followed, and as our tongues met, I had the first of many orgasms for that afternoon.....

Reminds me of a Frank Herbert book ... (1)

Introspective (71476) | more than 12 years ago | (#3868293)

called The White Plague, if you haven't read it, the story goes a bit like this :

A biochemist witnesses his wife and children getting killed in a car bomb explosion in Dublin, Ireland. After suffering a deep depression, he goes into hiding in the US and after a couple of years he develops a new contagious virus which infects and kills women only. He releases it in Ireland and, IIRC, Algeria and some other terrorist states by posting infected dollar bills to people in those countries. Of course, the virus sooon spreads to other countries and Frank Herbert doesn't hold back in graphically describing the pain, suffering, and insanity.

It makes a very powerful story in light of recent events, and is well worth reading of you can find a copy.

If Anthrax-in-the-post worried you, this story would scare the shit out of you.


Anonymous Coward | more than 12 years ago | (#3868299)

I have a DICK that's FULL OF LOVE for you.

Thank you.

Ask Slashdot (3, Interesting)

cDarwin (161053) | more than 12 years ago | (#3868310)

Question for molecular biologists in slashdot land:

How hard would it be to reduce this to a stepwise procedure that any reasonably intelligent, resourceful, dedicated person could carry out?

Making LSD from scratch required a lot of skill. But with detailed how-tos now widely available, practically anyone can make acid.

It's Hard (5, Interesting)

krmt (91422) | more than 12 years ago | (#3868415)

This would be a major, major, major pain in the ass to reproduce.

Doing this kind of work takes a lot of time and skill and equipment. It's not particularly hard to get the stuff, but you do need stuff, and the knowledge to go about doing it, and you're not just going to get that knowledge from nowhere.

This team worked for 2 years on this, and they are dedicated scientists with plenty of experience in this sort of work. How long would it take one person working in a home lab to start from scratch? Well over two years. If they don't know anything about Molecular Biology besides what they got out of high school (like your LSD-making example) probably at least triple that.

Everyone is very paranoid about the synthetic virus thing. This is hard work. No, what's more scary is the technology that's been around for three decades or so now, which is the ability to modify existing viruses. Why would someone really go to the trouble to make a new superbug from scratch when they can just use what nature's already done?

Or do you think that you can do a much better job than evolution has over millions of years?

Not that there aren't problems with creating superbugs (even Ebola and HIV have major weaknesses) and it wouldn't be easy, but it'd be far easier to modify something that already exists than it would to build something from scratch.

Build your own troll (-1)

Mode0x13 (550144) | more than 12 years ago | (#3868314)

TrollTech version 2.0.14 (Crapola) running on i286-dosbox

Entering postlevel: -1
probing OK
BSD is dying... OK
Mounting Natalie Portman... OK
nportman: Covered in hot grits
nportman: naked and petrified

Slashdot losers: found
slashdot: 10 stories on front page
slashdot: 5 linux FUD articles
slashdot: 2 feebleminded rants
slashdot: 2 recycled articles
slashdot: 1 junk science story
slashdot: this is not news for nerds, stuff that matters.

Registering troll personalitires...
Wintroll 3.0 (c) 1998 Redmond
Right Wing Troll: found. Loaded at 0x1950
Jon Katz (c) VA Linux

Welcome to TrollTech. HTH. HAND.



Spit Kiddies! (2, Funny)

tchdab1 (164848) | more than 12 years ago | (#3868315)

Now we'll get hassled by spit kiddies - anyone that can follow a sequencing recepie will be generating these things.

Very troubling this is! (0)

Anonymous Coward | more than 12 years ago | (#3868322)

Isn't anyone else out there disturbed by this? We just might end up whipping out man kind!

I want to change my name (-1)

confucio-licious (555476) | more than 12 years ago | (#3868339)

I am changing my name to Fuckforce Lambroghini.

Catalog? (1)

thelinuxking (574760) | more than 12 years ago | (#3868340)

'To construct the virus, the researchers say they followed a recipe they downloaded from the internet and used gene sequences from a mail-order supplier.' This sounds like its nothing revolutionary...first, the recipe apparently was already on the internet in public access...and they used parts from a mail order catalog! How come whenever I read those science magazines, it never has advertisements for the "Make your own Virus...In Your Home!" kit? Seems to me that if its so impressive and potentually harmful, it wouldn't have already been posted on the internet!

Smells like (0)

Anonymous Coward | more than 12 years ago | (#3868343)

The White Plague by Frank Herbert. Woopie!

Animals Were Hurt! (0)

Anonymous Coward | more than 12 years ago | (#3868344)

Having constructed the virus, which appears to be identical to its natural counterpart, the researchers, from the University of New York at Stony Brook, injected it into mice to demonstrate that it was active. The animals were paralysed and then died.
They can't claim animals weren't hurt can they? I am sending in the PETA team as I type.

In other related news... (0)

Anonymous Coward | more than 12 years ago | (#3868411)

As i clean out my grain silo, I crush the heads of every mouse I see and mail them to PETA's PO Box in San Francisco, California.

That would make a gread science project! (0)

Anonymous Coward | more than 12 years ago | (#3868421)

To make an application that constructs actual living virii to be injected into a Microsoft Windows system using an infected floppy disc, CDROM, or internet connection. Uhm, doesn't such a tool already exist? It's called MS Macro Assembler...Ahh, now i remember...

I'm feeling sick... (1)

I_am_Rambi (536614) | more than 12 years ago | (#3868347)

*Cough, Cough*

Don't worry, I just caught a synthetic virus. I'll be well in a few days...

It's not an accident DNA is digital. (1)

Kjellander (163404) | more than 12 years ago | (#3868349)

I'd better go and backup my genome to CD-ROM, so I can be restored later, in case of an accident...

Not the first virus (-1, Troll)

Anonymous Coward | more than 12 years ago | (#3868375)

This is really not the first synthetic virus. AIDS is synthetic. They "tested" it among African villages ravaged by smallpox. All those villages that recieved
vaccines become infected.

/me Welcomes the flames!

Biological Genie (0)

Anonymous Coward | more than 12 years ago | (#3868376)

This is the most disturbing thing I've read in a long time. Scientists could not keep the nuclear genie in the bottle, and they won't be able to keep the biological genie in the bottle, either. And it will be worse if it becomes easy to design biological viruses. Next thing you know and we'll be needing vaccines more frequently than Microsoft security updates. I'm afraid that ultimately, the knowledge which we use to destroy disease will be the the knowledge that we use to destroy ourselves.

Right (1)

fizban (58094) | more than 12 years ago | (#3868380)

Just like Slashdot to take a deadly serious issue and turn it into light-hearted fun!

AV companies have gone too far.... (1)

mike3411 (558976) | more than 12 years ago | (#3868382)

Wow, I pretty pissed when McAfee started publishing fake virii like the JPEG thing, but this time they've clearly gone too far....

Of course, if you aren't using MS DNA, you should be fine. Just another example of the benefits of Homo *NIX.

NOT the first one (0)

Anonymous Coward | more than 12 years ago | (#3868383)
"The transcript that follows is taken from the June 9, 1969 Senate
testimony of Dr. Donald MacArthur, a high-level Defense Department
biological research administrator. For those who hold the theory that
AIDS is the result of a U.S. biological weapons program--discussed in
chapter 40 of 60 Greatest Conspiracies of All Time--this testimony is a
smoking gun, or smoking petri dish as the case may be. We present it
without further comment. Judge for yourself."

Funding was approved in 1970 - $10 million to the DOD.

Disturbing (2)

theolein (316044) | more than 12 years ago | (#3868387)

This frightens me badly. Judging from the success that the FBI have had at tracing certain people involved in last year's Anthrax spree (at least one of the suspects was involved in biowarfare trials against blacks in South Africa in the '80s), I shudder to think what one pissed off reseacher could do and how the inept security agencies would not be able to do anything about it.

ebola ain't no joking matter (1)

knitting fool (542573) | more than 12 years ago | (#3868389)

it was possible that viruses like Ebola could be assembled in laboratories, but there were only a few people in the world with that skill.

i would like to think anyone who has read The Hot Zone by crighton is being plagued by the same tingles of fear running up and down their spines. all it takes is one of the few... the hot zone is about an ebola outbreak, and the descriptions of liquidized organs seeping out every opening is enough to give ghengis kahn nightmares.

The virus and the secret life of apples. (0)

Anonymous Coward | more than 12 years ago | (#3868400)

I don't care about either. I have yet to solve the mystery of why deer are immune to lime disease from deer ticks and other animals aren't.

live virus (1, Troll)

Veteran (203989) | more than 12 years ago | (#3868406)

The definition of stupidity is doing something just because you can, and for no other reason.

Evidently these people don't understand the difference between 'could' and 'should'.

Since these ethical idiots have now demonstrated that building an artificial virus is possible it is only a matter of time before someone (since the gnome is available) rebuilds a small pox virus and lets that loose on the world.

mail order genome (0)

Anonymous Coward | more than 12 years ago | (#3868412)

This is nothing new. I graduated from college 3 years ago. While obtaining a BS in Chemistry, I took a DNA sequencing class where we learned EXACTLY how to construct DNA chains with proper shielding of the substituatnts (anything other than the N-C-CO chain). This was an undergrad course, people.

Of COURSE there are going to be mail order catalogues to get these bases. Why go to the extra effort to create your own when you can get pure ones? And this isn't some stupid "science magazine" as has been suggested. These are catalogues that biologists and others can order from to create their own strands from isolated ones(like DNA duplication anyone?) and see the effects of certain genes rather than taking a large sample of blood and sorting out the specific gene they want for instance.

Gee, at least the method is really secure.. (1)

zytheran (100908) | more than 12 years ago | (#3868423)

"Responding to criticisms that such research could lead to bioterrorists engineering new lethal viruses, the scientists behind the experiment said that only a few people had the knowledge to make it happen."
Well this makes me feel safer because we all know so well how security through obscurity works. Just as well only a few chemists know how to make ecstasy too, otherwise all sorts of undesirables would be making illegal drugs, and we know that doesn't happen either. It's not as if anyone can get the recipe for that of the internet either. And of course, middle class people fighting for a cause would never bother getting degrees in biochemistry. (or learn to fly jets) Is there any sort of weird maths that allows for individuals to have really high IQ, and all IQ's to be positive, and yet overall the mean appears to be negative??

Things to think about... (0)

Anonymous Coward | more than 12 years ago | (#3868427)

Has the smallpox virus been sequenced? If so,
eradicating it in the wild doesn't really elimanate
the threat, since someone could simply download
the code and fire up the old dna sequencer. Yikes.

They *think* they made an exact copy... (4, Interesting)

pstav (589582) | more than 12 years ago | (#3868429)

But a slight change in the molecular make up of the man made Polio renders this new virus unrecognizable to the antibodies devoloped by the Salk vaccine.

Be very afraid...

Load More Comments
Slashdot Login

Need an Account?

Forgot your password?