Beta

Slashdot: News for Nerds

×

Welcome to the Slashdot Beta site -- learn more here. Use the link in the footer or click here to return to the Classic version of Slashdot.

Thank you!

Before you choose to head back to the Classic look of the site, we'd appreciate it if you share your thoughts on the Beta; your feedback is what drives our ongoing development.

Beta is different and we value you taking the time to try it out. Please take a look at the changes we've made in Beta and  learn more about it. Thanks for reading, and for making the site better!

cancel ×

276 comments

Consider the Savings (5, Funny)

carb (611951) | more than 11 years ago | (#4397129)

If you bring your own disc, that'll only come to $499,990.00

Re:Consider the Savings (0)

eamber (121675) | more than 11 years ago | (#4397152)

Jesus dude - $10 for a CDR? I get them for about $0.15

Re:Consider the Savings (1)

HungWeiLo (250320) | more than 11 years ago | (#4397163)

But after a $10 Office Depot rebate + $15 instant rebate + $19.99 manufacturer's rebate, you'll end up paying even less!

Watch out. (3, Insightful)

hateddamntruth (547045) | more than 11 years ago | (#4397359)

""Venter says he plans to offer the service, with the goal of burning individual human's entire DNA sequences onto shiny compact discs. It will cost about $500,000 per person, says the entrepreneurial scientist who helped decode the human genome."

Even though it's you, you know they will copyright it.
And even though it's you, you know they will prevent you from copying and sharing it.

Bad what people do for money.

Repeat... (-1, Troll)

Anonymous Coward | more than 11 years ago | (#4397131)

Troll? Try informative. (0)

Anonymous Coward | more than 11 years ago | (#4397165)

Can't accept it when you make a mistake and post a story twice?

I'll second that... (0)

Anonymous Coward | more than 11 years ago | (#4397397)

They seem to have a habit of doing that, not to mention posting stories that are a year old...

Me for sale! (1)

Valiss (463641) | more than 11 years ago | (#4397133)

Great, now I can pick and choose my good triats (I have those, right?) and sell them on EbaY! So long as can get past the copywrite burn protection, that is. Oh wait, I have a felt tip marker here. =]

Re:Me for sale! (-1)

Whistler's Mother (539004) | more than 11 years ago | (#4397149)

WTF are TRIATS BIATCH?!

Re:Me for sale! (0)

Anonymous Coward | more than 11 years ago | (#4397308)

choose my good triats

Like good spelling? :)

Re:Me for sale! (2)

MoneyT (548795) | more than 11 years ago | (#4397322)

I wonder if this would violate ebay's rules against biological items or not.

Re:Me for sale! (1)

SilentDissonance (516202) | more than 11 years ago | (#4397408)

Valiss said:

Great, now I can pick and choose my good triats (I have those, right?) and sell them on EbaY! So long as can get past the copywrite burn protection, that is. Oh wait, I have a felt tip marker here. =]

No, actually, you can't. I'm going to bet that the eBay Police will say no because of their Questionable Items [ebay.com] page, specifically the Human Parts and Remains [ebay.com] part.

After all, they got all pissy when you try to sell your soul [collegeclub.com] on their site.

Re:Me for sale! (1)

Emperor Igor (106953) | more than 11 years ago | (#4397437)

So long as can get past the copywrite burn protection, that is.

That'd be funny. You pop your genome CD into your Mac and it fries the shit out of it!

I wonder... (2, Interesting)

Innominate Recreant (557409) | more than 11 years ago | (#4397139)

what it would sound like. Take the data on the CD, convert it to MP3 or OGG and then have a listen. While most of our "songs" would sound the same, I suppose some filters could be applied to record only the major differences. It might make for some interesting electronica.

Re:I wonder... (2, Funny)

agdv (457752) | more than 11 years ago | (#4397194)

I know it's not nearly the same, but have you heard of the Who song Baba O'Riley?


(Score:1, The Who Reference)

Re:I wonder... (3, Interesting)

stile (54877) | more than 11 years ago | (#4397203)

This has been done before. Years ago, I don't know where, I heard of someone making "DNA Music". They took A,C,T,G, and mapped them to musical notes: A->A, C->C, T->E, G->G. Fits rather nicely into the key of C major. Then they would just "play" a dna sequence and see what came out... Unfortunately, I have no links to post, I lost wherever I first heard mention of this (discover magazine, maybe?) and haven't found it since. Anyone?

Re:I wonder... (2, Informative)

jetlag11235 (605532) | more than 11 years ago | (#4397374)

Many links can be found at:
linkage.rockefeller.edu/wli/dna_corr/music.html

I can't say that I tried them all ... but one link near the bottom was rather interesting. Thymine in particular is worthy of checking out. AIFF format.
www.healingmusic.org/SusanA/order.html

OMFG (0, Redundant)

chainrust (610064) | more than 11 years ago | (#4397141)

I'll do all this for 50 cents outside my home. I am prepared to prick your finger with a needle, and do exactly what Venter is doing with a 1,000,000% discount!

Fire your accountant, first. (1)

MisterSquid (231834) | more than 11 years ago | (#4397343)

I wouldn't trust you with my genome considering you can't even do simple arithmetic.

A 100% discount means you'll do it for free. Anything over that and you'd be more than bankrupt.

repost (2)

Jucius Maximus (229128) | more than 11 years ago | (#4397146)

This article has been done before [slashdot.org] !

Re:repost (1)

dennison_uy (313760) | more than 11 years ago | (#4397170)

Yes, but this one's cheaper.. only $500,000 as opposed to $621,500

Re:repost (0)

Anonymous Coward | more than 11 years ago | (#4397182)

It's the same guy, making the same statements, with them using a round number like "about $500,000 per person." Because, if you're going to spend $500,000 on this, you'll probably have no problem spending $625,000.

Re:repost (1)

skeedlelee (610319) | more than 11 years ago | (#4397268)

Thought the article was familiar, figured slashdot was just late in reporting it, turns out they're redundant instead.

I carry my genes about with me everywhere anyway. (4, Funny)

Moderation abuser (184013) | more than 11 years ago | (#4397150)

And it doesn't cost me a penny!

Re:I carry my genes about with me everywhere anywa (1)

Tablizer (95088) | more than 11 years ago | (#4397300)

Come to think of it, it is a lot cheaper to yank off onto a CD than do it their way. Both contain the same info, one just smells better.

Re:I carry my genes about with me everywhere anywa (0)

Anonymous Coward | more than 11 years ago | (#4397329)

Come to think of it, it is a lot cheaper to yank off onto a CD than do it their way.

Imagine a Beowolf cluster of these

Re:I carry my genes about with me everywhere anywa (2)

Xpilot (117961) | more than 11 years ago | (#4397345)

And it's more usable in a biological format too :)

That's not the point? (2)

capt.Hij (318203) | more than 11 years ago | (#4397431)

Interesting. I had assumed the whole purpose was to make a back up. Compared to a contract with IBM it seemed like the price was justified.

Welcome to two weeks ago (0)

Anonymous Coward | more than 11 years ago | (#4397151)

Purchase your personal gene map [slashdot.org] as seen here on Slashdot. Seems the price has gone down a whole $100,000!

how big is the entire genome? (0, Offtopic)

gl4ss (559668) | more than 11 years ago | (#4397157)

like, is it 1 cd(i find it hard to believe, but not that hard) or 30? 1000?

now, what if you did that and then released it as a record.. and then sue everyone who had similar genes.. like, all who are blonde or redheaded..

(yeah stupid but i'm a b**ch

Re:how big is the entire genome? (2, Informative)

Captain Nitpick (16515) | more than 11 years ago | (#4397251)

like, is it 1 cd(i find it hard to believe, but not that hard) or 30? 1000?

Sources say there's about 3 billion base pairs in the human genome. If we assume a reasonably efficient encoding scheme, we can get 4 base pairs into a normal 8-bit byte without compression. This gives us a total data size of a little over 700 megabytes, uncompressed. Run it through gzip, and you could probably fit it onto one cd, definitely 2.

Re:how big is the entire genome? (5, Informative)

treat (84622) | more than 11 years ago | (#4397273)

ike, is it 1 cd(i find it hard to believe, but not that hard) or 30? 1000?

This website [ornl.gov] says that we have about 3 billion base pairs, 30 thousand of which are genes (the rest is the mysterious "junk dna"). There are 4 base pairs, therefore each base pair is 2 bits of data. That's about 7.5kb for all the genes, and 715MB for every base pair - which after compression should fit comfortably on a standard CD.

Re:how big is the entire genome? (0)

Anonymous Coward | more than 11 years ago | (#4397301)

That's about 7.5kb for all the genes, and 715MB for every base pair - which after compression should fit comfortably on a standard CD.

That simply won't work.
Else why are they still releasing dvd's when divx'es can fit on a stantard cd? :)

Oh, the price has gone down. (3, Informative)

titurel (228551) | more than 11 years ago | (#4397159)

From this first post [slashdot.org] : "Craig Venter, Time Magazine's Person of the Year in 2000 has a new hobby: collecting rich people's DNA. Millionaires are lining up to buy their personal gene maps for the cool price of USD$621,500."

Put one in space (2, Insightful)

B1ackDragon (543470) | more than 11 years ago | (#4397162)

This is the sort of thing I'd like to see put on a satalite flying through space, for possible future contact with intelligent species. Then they would have a good chance to study other lifeforms, even if we are long gone.

Re: Book that mentions this (0)

Anonymous Coward | more than 11 years ago | (#4397258)

Sir Arthur C. Clarke has said that his own favorite novel is "The songs of distant Earth", which was originally a short story. Set about 1,000 years in our future, it tells the story of the Earth's destruction as the Sun goes supernova.

While desperately working to build a giant starship to evacuate at least some people, scientists launch unmanned probes to other solar systems. They intend these automated probes to colonize planets so that humanity will survive in some form. For this purpose they're loaded with DNA from humans, animals, plants, etc. Machinery to do the work and some heavy-duty AI to run the show complete the package.

It's actually a great story and even had a cool soundtrack by the same name composed by Mike "Tubular Bells" Oldfield!

biological weapons in space (1)

MisterSquid (231834) | more than 11 years ago | (#4397379)

So humankind, in its death throes, would launch the first salvos of interstellar biological warfare.

Arthur C. Clarke is a terrorist!

It's a joke . . .

Re:Put one in space (4, Insightful)

Tablizer (95088) | more than 11 years ago | (#4397321)

This is the sort of thing I'd like to see put on a satalite flying through space, for possible future contact with intelligent species. Then they would have a good chance to study other lifeforms, even if we are long gone.

I think one would need reference info to put the code to use. It is kind of like having the machine code of an app without knowing the machine language.

you ain't fingerbangin' Mary Lou Rottencrotch (-1, Offtopic)

Anonymous Coward | more than 11 years ago | (#4397166)

is that how you like it?

The Fly (2)

dnoyeb (547705) | more than 11 years ago | (#4397168)

Gives a whole new meaning to a "bug" in your software...

Wow, this so much easier (5, Funny)

typical geek (261980) | more than 11 years ago | (#4397173)

than trying to find a suitable, willing girl to carry my genes, and probably almost as much fun, too!

Re:Wow, this so much easier (4, Funny)

jdkincad (576359) | more than 11 years ago | (#4397267)

It certainly be cheaper, too.

geez (1)

evacuate_the_bull (517290) | more than 11 years ago | (#4397452)

...willing girl to carry my genes, probably almost as much fun, too!
probably NOT, you definitely need to get laid my geeky friend! :)

you can only make one copy of the CD. (1)

SphynxSR (584774) | more than 11 years ago | (#4397178)

Or else it is a copy right issue. I can't wait to see people putting their genes on P2P networks.

RIAA (3, Funny)

rc27 (601744) | more than 11 years ago | (#4397179)

Just more proof that, one day, the RIAA will indeed own all of us.

Re:RIAA (3, Funny)

user32.ExitWindowsEx (250475) | more than 11 years ago | (#4397195)

Hilary Rosen, circa 2025: "All your DNA are belong to us."

Re:RIAA (1)

Nick Harkin (589728) | more than 11 years ago | (#4397411)

Or, slightly more accurately,

All Your Base-Genes Are Belong To Us

;-)

repeating story from Alzheimers victim (-1, Troll)

Anonymous Coward | more than 11 years ago | (#4397188)

god commander Keen...you shouldn't be allowed to post stories until you receive 18 canneings on your white ass. How many repeat stories have you posted recently? good moses dude...check your alzheimers level there spud.

One flaw, not everything is on the CD. (1, Informative)

wackybrit (321117) | more than 11 years ago | (#4397200)

Clever as he may be, his service does not provide a way that every detail about your DNA structure can be put onto CD. What will be on the CD is a large data file containing the pattern of how your DNA is built up, which chemicals are where, and so forth. However, what will be missing is the important data about how each chemical that forms your DNA is made up ITSELF.

So you'll get your CD alright, but the only people who could actually do anything productive with that data is the same company who made the CD for you! They have to keep the information about the chemical densities of DNA fragments on their own computers, since you need to have actual samples of the chemicals to do this, and you can't store chemicals on a CD.. only references to them!

It's like saying you can store a house on a CD. Sure, you can store the floor plan, and even the absolute position of every brick, but you can't store information about the chemical structure of the bricks or the glass. You take house plans and buy the parts from a building merchant.

Likewise, the genomes on the CD are just like architectural plans on building DNA, but you'd need to go to a 'DNA building merchant' like the scientist's fine company to actually find out what chemicals are referenced in the plans.

Unfortunately there's no way around this, and the guy offers a great service.. but just remember, while he's the only company out there, he pretty much has a stranglehold over the data you'll be taking away from him.

Say what? (2, Informative)

roystgnr (4015) | more than 11 years ago | (#4397255)

"Each chemical that forms your DNA" is adenine, guanine, cytosine, or thymine, and we've known the chemical structure of all those for decades.

Re:Say what? (1)

Tablizer (95088) | more than 11 years ago | (#4397292)

"Each chemical that forms your DNA" is adenine, guanine, cytosine, or thymine

Yeah, but my guanine is, well.......special!

Re:One flaw, not everything is on the CD. (0)

Anonymous Coward | more than 11 years ago | (#4397283)

moderators, just wondering, did you fail to mention after his totally incoherent sensless ramblings, that his sig was that of a first class troller-boy?

just a question, no offense intended to the FUCKING IDOIT WHO MODED THIS HORSESHIT UP.

Re:One flaw, not everything is on the CD. (2)

freeweed (309734) | more than 11 years ago | (#4397305)

Or you could just take high school biology and not worry about these mysterious 'chemicals' not being actually present on the CD. You also can't use the CD to impregnate women with, but I don't think anyone's gonna complain about that.

Re:One flaw, not everything is on the CD. (0)

Anonymous Coward | more than 11 years ago | (#4397335)

I've said it before, I'll say it again: science stories have nothing to do on Slashdot (at least not biology/medicine). The +4, Informative moderation of the parent piece of gibberish serves to further prove this.

What are you talking about?!?!? (2, Informative)

acidfast7 (551610) | more than 11 years ago | (#4397392)

As a biochemist/microbial physiologist this post TOTALLY BAFFLES me.

As another person who replied to this, I'd like to reiterate that the chemical composition of DNA is known. Composed of four different nucloside triphosphates (GATC) in an dynamically ordered structure.

If I follow your train of thought, than all of genomes that are sequenced are worthless to me and the scientific community because we aren't "the same company who made the CD".

Look here [nih.gov] at the National Center for Biotechnology Infortaion's Genomic Database. I'd assume you would receive something similar to this from Venter's group.

Also one can FREELY browse the human genome [nih.gov] and look for differences between your genome and those used to construct this draft of the genome.

the ultimate insult (5, Funny)

PaganRitual (551879) | more than 11 years ago | (#4397201)

cool, now i can get the DNA sequence of someone i really dont like, and use it as a coaster for my coffee at work.

"gee, if im using your genetic sequence to keep my desk clean, chances are i dont really care for your opinion either, huh?"

Assholes on CD (0)

Anonymous Coward | more than 11 years ago | (#4397220)

cool, now i can get the DNA sequence of someone i really dont like, and use it as a coaster for my coffee at work.

Nah. Just store it with your porn DVD collection right next to "Anal Gangbang".

Re:Assholes on CD (0)

Anonymous Coward | more than 11 years ago | (#4397353)

I got my DNA all over that CD, but by accident.

Re:the ultimate insult (0)

Anonymous Coward | more than 11 years ago | (#4397309)

Reminds me of the rumor that Stalin kept Hitler's skull as an ashtray on his desk...

Alright, start the clock... (2)

GeekLife.com (84577) | more than 11 years ago | (#4397214)

How long till the RIAA finds out how this violates the DMCA?

some questions (3, Interesting)

john82 (68332) | more than 11 years ago | (#4397215)

I don't see what the consumer gets for $500K, but I do see what the vendor gets: your DNA and a big chunk of money.

1) What keeps them from exploiting your DNA for their profit? Suppose they discover something profoundly unique about your DNA that has significant medical implication. Who has the rights to that information?

2) How is the information encoded on the CD? Is it proprietary or some kind of de facto standard? (Oh, so you want to use the information? We'll have to read that for you! $100,000 per reading!)

3) CDs last forever right? Thirty years from now I'll be able to use the information on that CD, right? Didn't think so.

What's the use ? (1)

kovi (52074) | more than 11 years ago | (#4397217)

other than interesting reading material (that is if you only know letters A,C,G and T)

What about patents? (1)

croftj (2359) | more than 11 years ago | (#4397219)

Won't this infringe on the gene sequences that have been patented by various companies and institutions?

Remember it may be your body, but someone else 'owns' your genes!

Will it fit? (1)

heaney (614128) | more than 11 years ago | (#4397227)

I don't remember too many details, but I do recall when the human genome was first completed, I recall reading somewhere that it would take something like 40 dual-layer DVD's to hold all the information.
Now since there is only 4 different pieces of data that need to be recorded, maybe it could be compressed. Thats two bits per letter instead of eight, right? That would still only bring it down to 10 dual-layer DVD's.

Re:Will it fit? (2, Insightful)

NewbieV (568310) | more than 11 years ago | (#4397282)

From the Human Genome Project FAQ: [ornl.gov]

Q. How big is the human genome?

The human genome is made up of DNA, which has four different chemical building blocks. These are called bases and abbreviated A, T, C, and G. In the human genome, about 3 billion bases are arranged along the chromosomes in a particular order for each unique individual. To get an idea of the size of the human genome present in each of our cells, consider the following analogy: If the DNA sequence of the human genome were compiled in books, the equivalent of 200 volumes the size of a Manhattan telephone book (at 1000 pages each) would be needed to hold it all.

It would take about 9.5 years to read out loud (without stopping) the 3 billion bases in a person's genome sequence. This is calculated on a reading rate of 10 bases per second, equaling 600 bases/minute, 36,000 bases/hour, 864,000 bases/day, 315,360,000 bases/year.

Storing all this information is a great challenge to computer experts known as bioinformatics specialists. One million bases (called a megabase and abbreviated Mb) of DNA sequence data is roughly equivalent to 1 megabyte of computer data storage space. Since the human genome is 3 billion base pairs long, 3 gigabytes of computer data storage space are needed to store the entire genome. This includes nucleotide sequence data only and does not include data annotations and other information that can be associated with sequence data.

As time goes on, more annotations will be entered as a result of laboratory findings, literature searches, data analyses, personal communications, automated data-analysis programs, and auto annotators. These annotations associated with the sequence data will likely dwarf the amount of storage space actually taken up by the initial 3 billion nucleotide sequence. Of course, that's not much of a surprise because the sequence is merely one starting point for much deeper biological understanding!

Contributions to this answer were made by Morey Parang and Richard Mural formerly of Oak Ridge National Laboratory; and Mark Adams formerly of The Institute of Genome Research. [01/01]

Copyright? (1)

ashkar (319969) | more than 11 years ago | (#4397229)

Ok, now this might sound ridiculous, but who would be suprised if the cd comes with a license agreement giving Mr. Greg Venter the copyright on the cd.

You could argue that the DNA is yours, and you can give a copy to as many people as you want, but let's say the data is in a proprietary format, hard linked with the software. Copying the software would be piracy and converting the data would be infringing the DMCA.

So, in addition to the large sum of 500 large US bills, you could be charged 10,000 for every extra copy. I'm not saying this is likely or even probable. Just possible.

Burn my jeans? (0)

Anonymous Coward | more than 11 years ago | (#4397242)

Is that the latest fashion now? I am so out of date! I thought that ripped jeans were the latest fashion.

Ventner is suspect already... (4, Interesting)

oliphaunt (124016) | more than 11 years ago | (#4397245)

Remember, this is the guy who swapped HIS OWN DNA [hclinfinet.com] with the "random sample" that was supposed to represent all of humanity. Maybe this DNA-on-a-CD scheme is what he wanted to do all along?

CD? (2)

Cyno01 (573917) | more than 11 years ago | (#4397253)

Why does it cost half a million dollars to get your genes on a cd when you can get 'em put on a t-shirt [cafeshops.com] for 50 bucks?

Re:CD? (0)

Anonymous Coward | more than 11 years ago | (#4397327)

Why pay 50 bucks? Just take a clean, black shirt, and spank off on it. DNA on a shirt for free (and you get your rox off, too)!

Re:CD? (2)

freeweed (309734) | more than 11 years ago | (#4397330)

Your DNA sample will be purified, amplified, expressed and analyzed according to funDNA protocols. A high-quality, clean stretch of quality base pairs will be extracted, combined with one of our designs, and then digitally transferred on to your new t-shirt, lunch box, or coffee mug!

Because the t-shirt folks aren't doing anywhere close to your entire genome, they state this right on the page you linked to, and a listing of 3 billion base pairs would have to be so small as to be unreadable, no matter HOW large your t-shirt size.

Wouldn't surprise me at all if 'funDNA protocols' just ignores anything input, and outputs random letters - how is the buyer going to confirm or deny it?

Does this count as releasing your source code??? (0)

nsigma (608187) | more than 11 years ago | (#4397254)

1. Release your genetic sequence on CD 2. ??? 3. Profit Sorry, couldn't resist! :-)

NO MORE FUCKING BUSINESS PLANS (0)

Anonymous Coward | more than 11 years ago | (#4397354)

Next time I see one of these things, I'm going to find out where you live and put an icepick through your computer monitor, and then through your eye socket. IT'S NOT FUNNY ANY MORE.

Post Your Genes on Slashdot - $0 (3, Funny)

miracle69 (34841) | more than 11 years ago | (#4397262)

Chromosome 1:
atgcgcctagtttatagcgagcgtatgctgatcagtctggtatggt tagt atcgatcgttagctactggtactgtgatgctgtgatgcgtatcgtatctg tgatgcgtatgctgtgatgctgtgggtggtgtggtgattatatatataaa atattttaaaaaaaaaaaaaaaaaaaaaagtgtctgtatgctgtgagctg tgactggttagtggcgtgcgcccccccccccccccccccgtattgggatt atttattatattatatatattatctctatcgcttctgcgtctgctgtgct gctgtgctctctcttcttcttttttttctctctcccgcggcgatgcatgc ggtcttgatcgttaggcttgtatgcgtggtacgtgatgctgtgtctgagt ctggtggatggtctggtctgatgcgttggattgc

Re:Post Your Genes on Slashdot - $0 (5, Funny)

freeweed (309734) | more than 11 years ago | (#4397350)

I suggest you contact a doctor immediately.

According to this, [harvard.edu] you are going to die from insanely shortened chromosome #1 any second now.

Re:Post Your Genes on Slashdot - $0 (1)

MrP- (45616) | more than 11 years ago | (#4397427)

CTGC CGTT CTCC AGAA CGAC CTAG CGCC AGAA CGAC AGAA CGCA CTCC CGTC CGAG CGAC CTAT
CTAT

(p.s. it says something if you decode it :)

(p.s 2 "dont use so many caps, its like yelling" yada yada yada yada yada)

What I wanna know is... (4, Funny)

DarkHelmet (120004) | more than 11 years ago | (#4397263)

Will a CD like this get me through the express line at an airport, regardless of whether or not I wear a turban.

Re:What I wanna know is... (2)

garcia (6573) | more than 11 years ago | (#4397389)

if you consider the "express line" that table they bring you to when you have a long beard or a turban.

Why a CD? (4, Funny)

Cyno01 (573917) | more than 11 years ago | (#4397278)

Could i get my genome sequenced onto vinyl?

you can already do that yourself (0)

Anonymous Coward | more than 11 years ago | (#4397279)

..Or you could just put a drop of blood on the back of the cd.

Then someone will be able to decode your dna with the appropriate technology in a few centuries, those 500k cd's won't be useful until then anyway.

Cooking Recipe. (5, Funny)

T-Kir (597145) | more than 11 years ago | (#4397285)

burning individual human's entire DNA sequences onto shiny compact discs

I can do that for less than $500k:

Ingredients:

One CD (make use of an AOL one for a change).

A skin or blood sample.

Preperation:

Put all the ingredients into a casserole dish, preheat oven to gas mark 9. When ready place casserole dish into oven and leave until black acrid smoke comes out of the oven. Et Voila, your DNA 'burned' onto a CD.

A nice keep sake for years to come! And as Nigella Lawson would say, "Absolutely Scrumptious"!

Value (3, Funny)

Anonamused Cow-herd (614126) | more than 11 years ago | (#4397298)

Sure, it's expensive, but think of the value! I mean, that's just pennies per gene! With all of that information you can.. uhh.... erm..... prove your genetic superiority! I mean, after they sequence your genes and find out that you share 99% of your genes with every other human on the planet, you can use the remaining 1% to find out absolutely nothing that you didn't already know about your phenotypical characteristics! I know -- I'm just getting too excited.

Now I just have to sell my stock in Venter's enterprise to affod it --- oh wait: I OWE 500 grand on ledger. Silly me!
Cheers,

Rip, Mix, Burn (0)

Anonymous Coward | more than 11 years ago | (#4397303)

Gives whole new meaning

Arrrr...tis true (0)

Anonymous Coward | more than 11 years ago | (#4397312)

I heard you could get it done for $5 from some pirates in Malaysia.

NIAAA (0)

Anonymous Coward | more than 11 years ago | (#4397324)

Great they will own us all.....I always wanted to pirate myself :--D

Oops. (0)

Anonymous Coward | more than 11 years ago | (#4397355)

Yet another Duplicate Story [slashdot.org] ...

Several possible replies (0)

Anonymous Coward | more than 11 years ago | (#4397373)

1. When does SP1 come out?
2. How long till I can just download it on KaZaa?
3. Does anyone have the md5 sums, I wouldn't want to get burned?
4. Is the CD licensed under the GPL?

Great business plan (2)

Frank of Earth (126705) | more than 11 years ago | (#4397380)

@fbiTopTen = wget("http://www.fbi.gov/mostwant/topten/fugitives /fugitives.htm");

foreach $criminal (@fbiTopTen) {
1. Download $criminal iso image from Kaaza
2. Clone
3. Put $criminal in enhanced growth chamber.
4. Get Lunch
5. Take $criminal to FBI and collect ransom
}

Profit!

Pothumus Cloning? (0)

Anonymous Coward | more than 11 years ago | (#4397382)

Probably for the rich who think they can be recreated after death.

OOPS!

One scratch and all we can get is a fruit fly.

I'll be an entrepeneur too! (0)

Anonymous Coward | more than 11 years ago | (#4397399)

I'll put your DNA on a t-shirt for free. Just unzip your pants for me.

Gives 'Open Source' a whole new meaning. (0)

Anonymous Coward | more than 11 years ago | (#4397401)

Imagine, taking someone like RMS or Linus, then burn their genes on to a CD and GPL it. Then They WIll be Truly Open Source.

By the time this could conceivably useful... (2)

carlcmc (322350) | more than 11 years ago | (#4397402)

What is the chance that you'll have an archaic CD-ROM drive in your computer to read it????

Broken Time Machine (2)

Ektanoor (9949) | more than 11 years ago | (#4397414)

This looks like one of those old stories about "overcoming his death by sending a message to the future".

Presently the only good potential customer I could see would be the one that dreams on making a copy of himself when medicine gets to advanced to achieve what can't do today. This thing goes on the same wave as the frozen cadavers, frozen human cells and the frozen human DNA. However we know that all this risk to degrade in time. So the idea of writing up one's DNA would be an intersting solution to these drawbacks. Is it?

No. Because CD are also not eternal. And besides there is a huge difference between genes and what comes up after. We humans are the less genetic species on Earth, and every detail on character, behaviour and knowledge is mainly a product of our everyday experience. We are formed under the circumstances we grow up, the conditions of our family, society and the world in the whole. Besides every single piece of experience can be very fundamental to our character.

Let's remeber an old tale that many people used on several SF tales - Adolf Hitler's clones. Would Adolf Hitler revive from his genes? Absolutely not. His copies wouldn't ever seen his strict mother and his father with that very character of an austriac small burocrat. He wouldn't have suffered that poisoning in Ypres battlefield and wouldn't have seen the turmoil of the Russian October Revolution beating on the doors of Germany. He would not be the same racist bastard because his antecessor managed to wipe out a good piece of Jewish population in Germany and this populistic view that "jews are to be blamed for everything" is hardly to be overused today. Who would really be the new Adolf Hitler is hard to predict. However I would believe that his fate would not be shinny. Because he would not have parents, his artificiality would probably hunt him for the rest of his life and society, with its stupidities, faiths and superstitions would always mark him as the "Butcher of the World".

Well, probably soon we will have "an holographic image of your brain on DVD" together with instructions to reproduce it... But even then I would hardly believe that anyone may get ready for eternity. What would happen if I suddenly travel 1000 ahead from now? Well, let's take someone 1000 before us, and think the SHOCK he would get:

Boxes showing people or talking.
Mettalic tubes that spit fire and make huge thunders.
Big metallic things that move without horses, some EVEN FLY like birds.
People talking to each other on distance.
Fire that burns without wood.
Some strange boxes, made of metal and something like glass, where people write some strange symbols that look like letters and pass huge amounts of time on them. Some of these boxes even play songs or seem to talk. Others show demons, dragons and even trolls.

In other terms - The Hell...

DVD Version? (1)

encrypted (614135) | more than 11 years ago | (#4397418)

Can I get mine on DVD or does that cost extra?

MD5 checksums for everyone! (1)

Crypt0rchid (470538) | more than 11 years ago | (#4397430)

1. Burn your genes on CD
1a. Insert the CD into your CD-ROM drive.
2. cat /dev/acd0c (or any other CD-ROM device ;-) | md5sum -
3. share it, print it, do whatever you want. You could even make a barcode from it, which results in a quite fancy tattoo on your forehead.

- MD5 checksum mismatch. No, you're not my mom ;)

Breakdown of Cost (1)

E-Rock-23 (470500) | more than 11 years ago | (#4397445)

$2000 - Getting your DNA mapped

$1 - Cost of CD-R

$10 - Burn Time Charge

$497,989 - Royalties that the RIAA says you owe the original artist (AKA Your Parents)

And out of that $497,989 --

$493,000 - RIAA Fees
$4,979.89 - Artist Royalty (1% of total Royalty Fee mentioned above)
$9.11 Actual RIAA loss due to P2P Network downloading of Gene Map ISO.

Cut to image of Brittany Spears [bbc.co.uk] selling her implants to prevent starvation...

The big question is (1)

jobugeek (466084) | more than 11 years ago | (#4397451)

does it have copy protection on it?

Consider This... (1)

gnarly (133072) | more than 11 years ago | (#4397459)

Human and chimp DNA are about 90% the same, they say. So all human DNA must be AT least 90% identical, if not 99%. Its only that last 1% which differentiates one human from another. Once the Human Genome Project is done, and all this DNA-in-common becomes public, you can burn 99% of your DNA on a CD for the cost of media, ie 10 cents.

People will complain that such general DNA is "not me!". But neither is "your" DNA you. A CD containing "your" DNA would be identical to a CD containing your twin brother's DNA. Are you your brother?

ps. Thanks for posting this story twice, I didn't get to comment the first time.

Hmmmmm (1)

BlackCobra43 (596714) | more than 11 years ago | (#4397466)

ggcacatcgacgatcgtacgtagcgcattatatttttcgatatcgtgcta gtcgtacgtatcgatgctgatgctagctagtcgatgctagtgctacgtag agtacgcatctcgatcgtagtgatctagctagctagtcgtgctagtcagc ttcgatgctagctaggcagtagcatctcgtagcacggattcgatgctagc tacgcatcgatgatcgatagtcgctcgctagatgatcgagcagcagctag a If you burn this to a cd,send a check for 20$ to DNA,po box 23234,california
Load More Comments
Slashdot Account

Need an Account?

Forgot your password?

Don't worry, we never post anything without your permission.

Submission Text Formatting Tips

We support a small subset of HTML, namely these tags:

  • b
  • i
  • p
  • br
  • a
  • ol
  • ul
  • li
  • dl
  • dt
  • dd
  • em
  • strong
  • tt
  • blockquote
  • div
  • quote
  • ecode

"ecode" can be used for code snippets, for example:

<ecode>    while(1) { do_something(); } </ecode>
Create a Slashdot Account

Loading...