Beta
×

Welcome to the Slashdot Beta site -- learn more here. Use the link in the footer or click here to return to the Classic version of Slashdot.

Thank you!

Before you choose to head back to the Classic look of the site, we'd appreciate it if you share your thoughts on the Beta; your feedback is what drives our ongoing development.

Beta is different and we value you taking the time to try it out. Please take a look at the changes we've made in Beta and  learn more about it. Thanks for reading, and for making the site better!

Genome of DNA Pioneer Is Deciphered

Zonk posted more than 7 years ago | from the watson-and-crick-and-franklin-oh-my dept.

Biotech 142

unchiujar writes "The New York Times reports that the full genome of James D. Watson, one of the discoverers of the structure of DNA in 1953, has been deciphered, marking what some scientists believe is the gateway to an impending era of personalized genomic medicine. A copy of his genome, recorded on a pair of DVDs, was presented to Dr. Watson on Thursday in a ceremony in Houston by Richard Gibbs, director of the Human Genome Sequencing Center at the Baylor College of Medicine, and by Jonathan Rothberg, founder of the company 454 Life Sciences. 'The first two genome sequences belonging to individuals are now being made available to researchers within a few days of each other. One is Dr. Watson's and the other belongs to J. Craig Venter, who as president of the Celera Corporation started a human genome project in competition with the government. Dr. Venter left Celera after producing only a draft version of a genome, his own, in 2001, which the company did no further work on. He has now brought his genome to completion at his own institute in Rockville, Md., and deposited it last week in GenBank, a public DNA database, he said.'"

Sorry! There are no comments related to the filter you selected.

That's What They Think! (1, Funny)

Anonymous Coward | more than 7 years ago | (#19360509)

In reality, they just sequenced his clone!

Re:That's What They Think! (-1, Offtopic)

poopdeville (841677) | more than 7 years ago | (#19360919)

The last few months I have been doing some research into the trolling phenomenon on slashdot.org. In order to do this as thoroughly as possible, I have written both normal and troll posts, 1st posts, etc., both logged in and anonymously, and I have found these rather shocking results:
  • More moderator points are being used to mod posts down than up. Furthermore, when modding a post up, every moderator seems to follow previous moderators in their choices, even when it's not a particularly interesting or clever post [slashdot.org]. There are a LOT more +5 posts than +3 or +4.
    Logged in people are modded down faster than anonymous cowards. Presumably these Nazi Moderators think it's more important to burn a user's existing karma, to silence that individual for the future, than to use the moderation system for what it's meant for : identifying "good" and "bad" posts (Notice how nearly all oppressive governments in the past and present do the same thing : marking individuals as bad and untrustworthy because they have conflicting opinions, instead of engaging in a public discussion about these opinions)
  • Once you have a karma of -4 or -5, your posts have a score of -1 by default. When this is the case, no-one bothers to mod you down anymore. This means a logged in user can keep on trolling as much as he (or she) likes, without risking a ban to post on slashdot. When trolling as an anonymous user, every post starts at score 0, and you will be modded down to -1 ON EVERY POST. When you are modded down a certain number of times in 24 hour, you cannot post anymore from your current IP for a day or so. So, for successful trolling, ALWAYS log in.
  • A lot of the modded down posts are actually quite clever [slashdot.org] , funny [slashdot.org] , etc., and they are only modded down because they are offtopic. Now, on a news site like slashdot, where the number of different topics of discussion can be counted on 1 hand, I must say I quite like the distraction these posts offer. But no, when the topic is yet another minor version change of the Linux kernel [slashdot.org] , they only expect ooohs and aaahs about this great feat of engineering. Look at the moderation done in this thread [slashdot.org] to see what I mean.
  • Digging deep into the history of slashdot, I found this poll [slashdot.org] , which clearly indicates the vast majority does NOT want the moderation we have here today. 'nuff said.

Feel free to use this information to your advantage. I thank you for your time.

Excuse me Dr. Watson... (5, Funny)

BrunoBigfoot (996441) | more than 7 years ago | (#19360523)

Torrent pls?

Re:Excuse me Dr. Watson... (4, Informative)

CharlesEGrant (465919) | more than 7 years ago | (#19360713)

It's not a torrent, but you can in fact download the complete sequence and traces [nih.gov] .

Is that all I am? (1)

nbritton (823086) | more than 7 years ago | (#19360981)

>gnl|ti|1741299339 name:1094373133425 mate:1742401149
gttgaaatgggacgttgatggggtgatgtctgttcagtcttcgctgttta aaaagtttgggttatttttattgtgaaactgttggggttttctgcacatt ctctagatacaagacccttaccagatttatgtgtgggagtatcccaccca ttctgaattgtgtccctttgtcttcctcatggtgtgcttaatcgttattt aacacttaaccatttttttatggctagtgcttttagccataaagtcctaa gaaatcttttcctacctcaaggtgacaaagatactctcctctgttctatt tttcatttttatattgtacacaacacttaaaaaataagtctaagtgttac tagctgagaaataccagaaaacaacttgcataaatgctgaaatcgaattg ctacccctattttggattgaaatgaatttgaagggggaagaatgtcacag ttactttagcctcattttctagcactggaactctaagtggacaggagtga aaggaactttatggtgaaatattttgagaaatataaaatatctttgtgta tcttggggtgtctttgactagcctgttgggccagtgaggcaggaactgcc ttctctctgcatggttagtgcatggctgtggtgtggaaggtttggactcg aatgctgagctcgtgggcagacggacaggcagctggaagtaaagacgtgc cctccattctaggctgggaggaactgatgagagctgtgattctgcaggct gcctccctctggagatggcactgagatctctctcagccagggtcccagag ccagttgatgtctgtgttgagtctactttaaagacataaaatgccccctt tcttttctttctttcttccgtttttttattttttttttttttgttataaa agacagagtctcgctctgttgcccaggctagagtgcagtggtgtgatctc gggtcactgtgaactccgcctccggatcacaccattctccctccctcaca ctccagagtagctgggactacagtgcccgccaccgccgcccgactaattt tgt

That's it, just 10^643 unique individuals? Anyone know if combination restrictions apply?

---
I feel so finite.

Re:Is that all I am? (2, Insightful)

Dunbal (464142) | more than 7 years ago | (#19361095)

Anyone know if combination restrictions apply?

      Yes, but most of them are not compatible with life, so chances are you don't have any.

Re:Is that all I am? (2, Funny)

Opportunist (166417) | more than 7 years ago | (#19361571)

Hey, just patent 'em all and the whole world belongs to you!

Re:Is that all I am? (2, Funny)

Smight (1099639) | more than 7 years ago | (#19361109)

I would assume that combinations which result in your brain being outside of your body or having five lungs and the liver of a titmouse, would be a pretty strong restriction.

Re:Is that all I am? (2, Funny)

Anonymous Coward | more than 7 years ago | (#19361205)

>gnl|ti|1741299339 name:1094373133425 mate:1742401149
gttgaaatgggacgttgatggggtgatgtctgttcagtcttcgctgttta aaaagtttgggttatttttattgtgaaactgttggggttttctgcacatt ctctagatacaagacccttaccagatttatgtgtgggagtatcccaccca ttctgaattgtgtccctttgtcttcctcatggtgtgcttaatcgttattt aacacttaaccatttttttatggctagtgcttttagccataaagtcctaa gaaatcttttcctacctcaaggtgacaaagatactctcctctgttctatt tttcatttttatattgtacacaacacttaaaaaataagtctaagtgttac tagctgagaaataccagaaaacaacttgcataaatgctgaaatcgaattg ctacccctattttggattgaaatgaatttgaagggggaagaatgtcacag ttactttagcctcattttctagcactggaactctaagtggacaggagtga aaggaactttatggtgaaatattttgagaaatataaaatatctttgtgta tcttggggtgtctttgactagcctgttgggccagtgaggcaggaactgcc ttctctctgcatggttagtgcatggctgtggtgtggaaggtttggactcg aatgctgagctcgtgggcagacggacaggcagctggaagtaaagacgtgc cctccattctaggctgggaggaactgatgagagctgtgattctgcaggct gcctccctctggagatggcactgagatctctctcagccagggtcccagag ccagttgatgtctgtgttgagtctactttaaagacataaaatgccccctt tcttttctttctttcttccgtttttttattttttttttttttgttataaa agacagagtctcgctctgttgcccaggctagagtgcagtggtgtgatctc gggtcactgtgaactccgcctccggatcacaccattctccctccctcaca ctccagagtagctgggactacagtgcccgccaccgccgcccgactaattt tgt


Gesundheit.

completely torn (3, Interesting)

farkus888 (1103903) | more than 7 years ago | (#19360567)

this is really really cool for obvious reasons. it's also really really scary for equally obvious reasons. if I wasn't so afraid of the potential harm of misusing this power I'd sign my name now to be the third person done.

Re:completely torn (-1, Flamebait)

shlinton (930512) | more than 7 years ago | (#19360683)

Who gives a sh*t about you?

Re:completely torn (1)

DirtySouthAfrican (984664) | more than 7 years ago | (#19360699)

I do!

Re:completely torn (3, Interesting)

kestasjk (933987) | more than 7 years ago | (#19361193)

Why is it scary?
  • If someone wanted your DNA for malicious purposes would they have any trouble getting it? Unless you're meticulous about security and burn all your trash, it'd be no problem.
  • What could they do with your DNA?
    • Trace you back to crimes? They can do that already by taking your DNA without consent.
    • Clone you? Nope, not yet at least, and what would they do with the clones?
    • Discover you have the "criminal gene"? These "criminal/musician/pedophile/libertarian/democrat" genes are nonsense.
  • My cousin did genetics at Oxford and, iirc, his professor told him that genetics wouldn't be useful for much in a long time, even to do good.
The scariest thing I can think of is having a national database of all genetic profiles, as it could have privacy implications. But that would be no scarier than having a national database of all fingerprints (but much more expensive).

Re:completely torn (1)

farkus888 (1103903) | more than 7 years ago | (#19361405)

I am concerned about people wanting to make decisions about who's life is more important than whose based on genetic dispositions to certain health issues. I don't think I should be passed up for a liver transplant from years of hard drinking because I have a genetic predisposition to parkinsons or diabetes.

Re:completely torn (1, Insightful)

Anonymous Coward | more than 7 years ago | (#19361803)

I don't think I should be passed up for a liver transplant from years of hard drinking because I have a genetic predisposition to parkinsons or diabetes.

I would deny you the liver implant based solely on your hard drinking. All unlucky souls that need a new liver because of a disease should get it before you who knowingly killed your own liver get a new.

Re:completely torn (1)

espressojim (224775) | more than 7 years ago | (#19362867)

IAAG (I am a geneticist, and a bioinformatician, too), and knowing your complete sequence does give us lots of interesting info about your susceptibility of many genes.

One thing you (and that's the slashdot you) know is that in the last few years we've had a moore's law ^2 increase in the amount of data we're gathering and analyzing. This is leading us to a huge increase in our understanding of humans and disease. 5 years ago, it was a pipe dream (or a million dollar project) to do a complete genome scan of an individual. It's now common place, and costs just a few hundred dollars (thus, we do it on thousands of individuals at a time to have the sample size for proper statistics and sensitivity.)

We could look at Craig V's sequence, and tell him about all the increased risk he has. On the other hand, I don't know that anyone in the academic community has ANY love for the guy at all.

Re:completely torn (1, Interesting)

MikShapi (681808) | more than 7 years ago | (#19361369)

Harm? And I thought all the "Be scared of Hitler Clones" has subsided.

Dude, if we mastered electricity, nuclear technology, chemistry, biological warfare and millions of 1+ ton hunks of metal whizzing around at 100km/h all over the the planet's surface, and made humanity benefit from all the above, do you REALLY think personalized medicine as a consequence of knowing your personal genome would do more bad than good to warrant "being afraid of the technology"?

Gimme a break. 1978 called, they want their hitler DNA back.

Re:completely torn (1)

Wolfrider (856) | more than 7 years ago | (#19361651)

--They gave it to him on (2) DVD's. Couldn't they have just burned it to a dual-layer?
:b

Good result, disappointing scientist / human (5, Informative)

Anonymous Coward | more than 7 years ago | (#19360595)

For the curious, read a pretty good synopsis of Dr. Watson here: http://en.wikipedia.org/wiki/James_D._Watson#Contr oversy_about_using_King.27s_College_London.27s_res ults [wikipedia.org] , and if you are extremely interested, pick up a copy of "The Double Helix." It is really strange, but even his autobiography makes him sound like a total ass, and includes an apology of sorts in the revised version, which is commendable.

In short, Watson stole a lot of data, and the structure of DNA would have been determined in less than a couple months by the more deserving Linus Pauling, who has conducted himself in a much more dignified fashion. It is really strange how superficial history records events, with the "first" often the most noisy, obnoxious scientist / engineer / artist, and not the industrious, studious type.

Well, perhaps they will find some genes responsible for the "jerk" phenotype... (at work, have to post AC).

Re:Good result, disappointing scientist / human (2, Funny)

mythar (1085839) | more than 7 years ago | (#19360695)

it's okay, linus. we appreciate your input.

Well, he was (and still is) of poor character... (5, Informative)

WIAKywbfatw (307557) | more than 7 years ago | (#19360747)

Yes, the man was part of a team that made a huge scientific breakthrough. If someone wants to argue that that makes him a genius, well, I won't start an argument on that front. But there's no doubt that Watson was (and still is) also of poor character.

He and his colleagues knowingly stole vital DNA X-ray diffraction data from Rosalind Franklin and Raymond Gosling without their knowledge and consent (indeed, Franklin had even refused to share it), which tarnishes their acheivements.

More recently, he has called for genetic screenings before birth to weed out "really stupid" people (the bottom 10 percent or so), and he has a nice line in how to deal with homosexuality, too. He believes "that if the gene [for homosexuality] were discovered and a woman decided not to give birth to a child that may have a tendency to become homosexual, she should be able to abort the fetus." Not to put too fine a point on it, but that strikes me as being rather too close to Third Reich thinking for my liking.

He might have performed some fantastic science but, to me, his words preclude him from being considered a great scientist. Certainly they show that he's not a great human being.

Re:Well, he was (and still is) of poor character.. (1)

Chandon Seldon (43083) | more than 7 years ago | (#19361001)

More recently, he has called for genetic screenings before birth to weed out "really stupid" people (the bottom 10 percent or so), and he has a nice line in how to deal with homosexuality, too. He believes "that if the gene [for homosexuality] were discovered and a woman decided not to give birth to a child that may have a tendency to become homosexual, she should be able to abort the fetus." Not to put too fine a point on it, but that strikes me as being rather too close to Third Reich thinking for my liking.

I don't agree that anything that even vaguely resembles eugenics is always bad. I'm sure of the following: Government mandated executions based on genetic makeup is bad and pregnant women having the option to abort terminally-ill fetuses is good. There's a lot of ground in the middle. If we take "a woman's right to choose" as given, then I don't see any reason why aborting a stupid or gay fetus is any worse than aborting a generic unwanted fetus.

Your response is an excellent example of an ethical heuristic in action - the "anything that looks like what the Nazis did is bad" heuristic is probably a good one. But, you've got to remember the basic thing about heuristics - they're fast but don't always produce the correct result.

Re:Well, he was (and still is) of poor character.. (2, Informative)

WIAKywbfatw (307557) | more than 7 years ago | (#19361061)

No. Sorry, you've got me wrong here, friend. It's not a case of "anything that looks like what the Nazis did is bad", it's a case of what he said isbad.

Abortions because of a likelyhood of low IQ or homosexuality? That doesn't abhor you? I'm all for a woman's right to choose not to have a baby (it's her body, it's her choice) but to make that choice available on the basis of likely intelligence or sexuality (or hair colour, or skin tone) is, to me and most people, a step too far.

OK, if a foetus is going to result in a severe genetic abnormality (such as a severe mental or physical disability) then I can see why the option of an abortion should be made available but that's a whole different kettle of fish.

Re:Well, he was (and still is) of poor character.. (2)

Longtime_Lurker_Aces (1008565) | more than 7 years ago | (#19361119)

If it wasn't such a serious issue, watching pro-abortion people try to justify their position would be funny.

Its not a baby or not a human life so its okay to kill it... unless your reason for killing it is wrong because then it is a human life.

If abortion hadn't gotten tied into religion, then everyone with a high school education would accept that on simple biological grounds a fetus is a human life. Claiming otherwise is burying your head in the sand as much as the creationism people.

Re:Well, he was (and still is) of poor character.. (1)

ZorbaTHut (126196) | more than 7 years ago | (#19361527)

There is, in fact, a difference between those cases.

Abortion is rarely chosen due to features of the baby. It's generally because of the mother's situation in one way or another.

Eugenics, on the other hand, is based entirely on the baby. It puts people in the position of being able to choose "good" features, and have a "proper" baby. This is dangerous on several levels, potential prejudices in both directions and gene pool reduction being two of the more important ones.

The fact that a fetus is being destroyed is not, in my opinion, the part that makes eugenics nasty. The part that makes eugenics nasty is what it means for the remaining children.

Re:Well, he was (and still is) of poor character.. (1)

Chandon Seldon (43083) | more than 7 years ago | (#19361163)

Abortions because of a likelyhood of low IQ or homosexuality? That doesn't abhor you? I'm all for a woman's right to choose not to have a baby (it's her body, it's her choice) but to make that choice available on the basis of likely intelligence or sexuality (or hair colour, or skin tone) is, to me and most people, a step too far.

No, using more information to make an important decision doesn't seem abhorrent to me at all. A pregnant woman has the right to chose to abort the fetus. It's her body, it's her choice, and what information she uses to make that choice is her business.

If there were government criteria for mandatory abortions, then that would be a completely different story - but there are a lot of things that people should be free to do but shouldn't be mandatory, bar code tattoos for example.

As for your "me and most people" comment, I doubt that most people have even legitimately considered this question. Sure, a lot of people's gut reaction would be to agree with you - but a lot of people would initially support the new New York law that makes selling violent video games to kids a felony. Hopefully, in both cases, a little bit of consideration would cause them to rethink their initial position. People should generally allowed to make choices for themselves - the choice of what information to use in deciding whether to carry a fetus to term isn't an exception.

Re:Well, he was (and still is) of poor character.. (1)

Tomfrh (719891) | more than 7 years ago | (#19361779)

If it's truly HER body and HER choice, then why should someone else's opinion of her reasons matter at all?

Re:Well, he was (and still is) of poor character.. (1)

Dunbal (464142) | more than 7 years ago | (#19361091)

that if the gene [for homosexuality] were discovered

      This always makes me laugh. An inheritable cause for people who kind of by definition can't (or rather won't) have children. Yeah, homosexuality is a "gene"...

Re:Well, he was (and still is) of poor character.. (1)

zegota (1105649) | more than 7 years ago | (#19361105)

It's possible. Transmitted through the mother for gay men or the father through lesbians. I'm no geneticist, but I know enough to know that you can't definitively rule out genes having some influence on homosexuality.

Re:Well, he was (and still is) of poor character.. (1, Flamebait)

Dunbal (464142) | more than 7 years ago | (#19361215)

know enough to know that you can't definitively rule out genes having some influence on homosexuality.

      Yeah, the same argument is used to claim the existence of "God", because you can't "disprove it".

      I think it is a LOT more likely that homosexuals are so desperate for some sort of justification for their lifestyle to be accepted by society that a "genetic" theory suits them just fine. Aww, it's not THEIR fault. It's a gene.

Re:Well, he was (and still is) of poor character.. (0)

Anonymous Coward | more than 7 years ago | (#19361269)

How do you explain homosexuality when it occurs in individuals of other species in the animal kingdom, you Bible-thumping fucktard? /oops, did I just go all ad-hominem on you?

Re:Well, he was (and still is) of poor character.. (0)

Anonymous Coward | more than 7 years ago | (#19361325)

That doesn't even make sense. Did you even read his post or did you just see the word god and assume he was a bible thumper?

Something can be natural without being genetic. Many people have innocent heart murmurs. Having one doesn't say anything about your parents or childrens likelihood of having one. At this point, scientifically there isn't evidence to suggest homosexuality is genetic as opposed to any other possible cause.

Re:Well, he was (and still is) of poor character.. (1)

abigor (540274) | more than 7 years ago | (#19363355)

You don't understand genetics or biology.

"I think it is a LOT more likely..." Ahh right, there's your problem.

Re:Well, he was (and still is) of poor character.. (1)

doug141 (863552) | more than 7 years ago | (#19361189)

Don't confuse the last 300,000 years of human society with modern society. The modern standard of expressing a gay gene by "not having children" might not have been an option during the bulk of human evolution.

Re:Well, he was (and still is) of poor character.. (1)

doug141 (863552) | more than 7 years ago | (#19361225)

Don't confuse the last 300,000 years of human society with modern society. The modern standard of expressing a gay gene by "not having children" might not have been an option during the bulk of human evolution. Especially for lesbians.

Re:Well, he was (and still is) of poor character.. (1)

vidarh (309115) | more than 7 years ago | (#19362389)

You seem to think evolution can't lead to genes that preclude survival of individuals from becoming widespread, but that's bullshit. Evolution doesn't "care" about individuals - what matters is if the expression of the gene causes a net increase in the odds of someone surviving and passing on their genes than without it.

If one or more genes lead to homosexuality or increase the chances of it when they are expressed alone or together, then clearly those genes would need to have other effects alone or together that would cause a net beneficial effect in terms of the spread of those genes. There would be nothing unusual with that.

Trying to dismiss the idea with comments like that just makes you seem silly.

Re:Well, he was (and still is) of poor character.. (1)

squiggleslash (241428) | more than 7 years ago | (#19362469)

Yeah, because gay men never marry and have children to "fit in". There are no recorded cases in history of gay men with children.

More seriously, I'm wondering how stupid, or simply cut-off from the real world, you have to be to make that kind of comment.

Re:Well, he was (and still is) of poor character.. (1)

my $anity 0 (917519) | more than 7 years ago | (#19362517)

IANAGE, but I am studying to be one.

The possibility of a gene for homosexuality is present, because all men inherit their X chromosomes through their mothers. Even if no gay men reproduced, we'd still have gay men, especially if the same gene provided some advantage to the mother, let's say larger breasts. It will be selected FOR in females, despite being selected against in males.

Lesbians don't have a similar mechanism, but, in the dark old days, you really didn't need to ask a ladies permission. Except if you're me.

So, conclusion: I'm a weakling.

Re:Well, he was (and still is) of poor character.. (1)

blahplusplus (757119) | more than 7 years ago | (#19361467)

"He believes "that if the gene [for homosexuality] were discovered and a woman decided not to give birth to a child that may have a tendency to become homosexual, she should be able to abort the fetus." Not to put too fine a point on it, but that strikes me as being rather too close to Third Reich thinking for my liking."

Aborting a homosexual fetus is a little like aborting an Asperger fetus, someone who is just different and who certain segments of society shun, but in the case with Aspergers, the shunning is much more widespread.

People are prejudiced and racist, its built in, you may not think you are racist/prejudice, but what exactly is friend and mate selection if not a form of *natural* prejudice based, eugenics? you look for the traits in others you favor or that do not cause your nervous system revulsion or aggravation. 90% of the people on earth associate with others based on 1) How they look 2) How they behave and 3) What value it adds to their life goals.

In this world discrimination is the norm, the fact that Eugenics got associated with the 3rd reich should not mean much since almost all nations were in on eugenics before that point. Designer people are the future whether you want to admit it or not, and capitalism and market society are leading the way. You only have to look at many successful people to realize that eugenic selecting is already happening.

Re:Well, he was (and still is) of poor character.. (1)

HappyEngineer (888000) | more than 7 years ago | (#19361825)

He and his colleagues knowingly stole vital DNA X-ray diffraction data from Rosalind Franklin and Raymond Gosling without their knowledge and consent (indeed, Franklin had even refused to share it), which tarnishes their acheivements.
Did they steal it or copy it? How was it "vital"? If it's scientific data then shouldn't it just all be public anyway? (I'm not flaming. I really want to know the answers.)

Re:Well, he was (and still is) of poor character.. (1)

Cadallin (863437) | more than 7 years ago | (#19362033)

It was stealing because they broke into her office and took it, or used a similar method equally dishonest. And that's completely apart from the issue of taking someone's unfinished work and then submitting it for publication as your own. What they did was close enough to plaigarism that I think the difference is insignificant. I've read about how it happened and basically Watson and Crick realized that whoever solved the problem of DNA structure would be famous. So they started bumming data off other scientists working on that and related problems, and in some cases resorted to actual theft. But they were right, they solved the problem and now they're famous and tenured. I think their submission of the correct answer (a scientific paper submitted to a journal whose name I can't remember) beat Linus Pauling's by mere hours.

The X-ray diffraction data was "vital" in the sense that it showed what the structure of DNA was, it was just necessary to interpret it correctly.

Re:Well, he was (and still is) of poor character.. (1)

Rich0 (548339) | more than 7 years ago | (#19362211)

I think part of the problem is the obsession among scientists of being the first to do something. Just think of all the grad students who spend 3 years on a project, only to get scooped by somebody else, and having to switch gears. Is their work somehow less original because it was done independently by somebody else ahead of them?

The same sorts of issues exist with negative results. Nobody cares about them, but they're just as important as positive results. Especially when everybody keeps reinventing the wheel because nobody bothers to publish that a given approach won't work.

I remember attending science classes at a smaller university and a large top-10 university. One thing that struck me as being different between the two was an emphasis on names. At the smaller university you'd just talk about the science. At the larger one every time a concept was mentioned it would also be mentioned who came up with it. I always figured that at the larger university it was due to a subconscious hope that the person doing the teaching would one day end up in one of those textbooks themselves. That and the fact that at larger universities there tends to be a lot more networking going on. Chances are that a professor at a small university will just do independant work and not collaborate with 14 other research groups (who all review each other's papers and grant applications).

Often I think the politics of large-scale science gets in the way. The same problem exists in private industry, but the desire to make a buck can cut through the red tape pretty quickly when the payoff is big enough...

Re:Well, he was (and still is) of poor character.. (0)

Anonymous Coward | more than 7 years ago | (#19362445)

"Certainly they show that he's not a great human being."

No doubt, he'd think you're an asshole... if he'd even heard of you...

Re:Well, he was (and still is) of poor character.. (1)

my $anity 0 (917519) | more than 7 years ago | (#19362479)

I remember in one of my required Honors courses, talking about the difference between the sciences and the humanities, which is, that the person doing the science shouldn't matter.

He's a great scientist because of his great science.

He isn't, however, that great of a person.

Incidentally, in 10th grade, someone in my class saw him enter a deli and order a sandwich (I live in one of the towns near Cold Spring Harbor. I could walk there. Takes me 2.5 hrs, but I could walk there.

Re:Well, he was (and still is) of poor character.. (1, Insightful)

Anonymous Coward | more than 7 years ago | (#19363343)

(posting anonymously as I'm in the field, and it's a small world)

I watched the live webcast of him accepting the (portable hard drive) that contained the genome data. He was kind of an ass, trashing DOE, former NIH administrators, and various and sundry others. My colleagues and I confirmed that he had definitely fallen into the "I'm old and famous and don't care what I say or who hears it" model. I was disappointed, as I had hoped he would have been gracious.

Re:Good result, disappointing scientist / human (2, Informative)

Bender0x7D1 (536254) | more than 7 years ago | (#19360749)

We also can't forget Rosalind Franklin - the "Dark Lady" of DNA [npr.org] , who first pohotographed the DNA molecule.

Re:Good result, disappointing scientist / human (0)

Anonymous Coward | more than 7 years ago | (#19362687)

"In short, Watson stole a lot of data"

Nonsense.

"the structure of DNA would have been determined in less than a couple months by the more deserving Linus Pauling"

Nonsense.

"It is really strange how superficial history records events, with the "first" often the most noisy, obnoxious scientist / engineer / artist, and not the industrious, studious type."

Nonsense.

"Well, perhaps they will find some genes responsible for the "jerk" phenotype... (at work, have to post AC)."

Or perhaps those responsible for idiot revisionists like you.

Two DVD disks? (2, Insightful)

MichaelSmith (789609) | more than 7 years ago | (#19360597)

So what's that, 16 gigabytes of information to describe one person. But this is a DNA profile, not necessarily something which can be turned back into DNA.

Re:Two DVD disks? (5, Interesting)

neapolitan (1100101) | more than 7 years ago | (#19360659)

I've often thought about this (I'm a doctor...)

By my calculations:

3 billion base pairs in the entire human DNA sequence (give or take). Each base pair can be A, C, T, or G. (look at wikipedia or biology text for details.) Thus, each base pair can be represented by a 2 bit number (00 01 11 or 10).

Thus, 3 x 10^9 base pairs * 2 bits / base pair = 6 x 10^9 bits = 6 billion bits * 1 byte / 8 bits = .75 billion bytes = .75 GB = 750 MB.

A standard DVD holds 4.3 GB, so you could fit almost 6 full humans on a DVD. Of course, this doesn't count compression (which would be astoundingly effective given repetition and patterns in DNA sequences) nor the fact you could just encode the delta as much DNA is conserved. In fact, very little DNA varies between humans, so I'd bet you could quite deterministically encode a human in as little as 100 MB if you had a "standard human DNA sequence" for reference.

Of course, you would need some magical method to reconstruct this DNA and put it into an egg at the right timing, which would likely form an approximation of the identical twin of a person. The technology for this is not here yet. Also, this does not encode any of the proteins / apparatus / mother that is needed to go from DNA in egg to functioning human.

Still, it is interesting to think about!

Re:Two DVD disks? (1)

DigiShaman (671371) | more than 7 years ago | (#19360855)

Of course, you would need some magical method to reconstruct this DNA and put it into an egg at the right timing, which would likely form an approximation of the identical twin of a person. The technology for this is not here yet.


How about "cyber synthetic biology"? Basically, digitally grow the organism via emulation. I bet this technology will be used to study and digitally dissect a dinosaur long before one is actually cloned.

Throw enough CPU power at it to emulate neural activity...and it might be "alive"

Could happen in the next 50 years. Ya never know ;)

Re:Two DVD disks? (1)

SolexaJoe875 (1110469) | more than 7 years ago | (#19360881)

The Human genome is about 3.5 billion bases, and you need 2 bits to encode 2 bases, which corresponds to 7Gigiabits of data. 1 byte is 8 bits. So you would need at least 875Megabytes to store your DNA. This, I'm sure, would be bloated somewhat with the extra encoding and CRC checking to ensure that a disk with your DNA isn't missing any bases.. Does anyone know how much more space would be required to ensure that the DNA is copied accurately? I've heard that disks use Reed-Solomon codes as a way of minimizing bit errors, while also minimizing the amount of extra data you'd need to store.. It would be interesting to find out how much more space, in addition to the 875MBytes you would need, the probability of a bit-error, etc.. http://www.4i2i.com/reed_solomon_codes.htm [4i2i.com] I work at a company that makes DNA sequencers, and feel excited to be in this business..

Re:Two DVD disks? (1)

ZorbaTHut (126196) | more than 7 years ago | (#19361507)

CDs and DVDs already contain error correction. If that error correction isn't enough, the first thing you'd need to do is figure out how much damage you expect to be able to recover from. If you're planning on keeping it in an armored container stored in a bank vault, you're probably fine - if you're planning on using it as a floor sander, you might have some trouble.

"How much" depends entirely on your needs.

Re:Two DVD disks? (2, Interesting)

wizardforce (1005805) | more than 7 years ago | (#19361011)

everyone talks about the actual coding sequence but not much about epigenetics- whether or not certain cytosine residues are methylated and what not- quite important if you think about it- put the whole sequence back together and certain genes dont quite work the same way. so really counting all of that it would take quite a significant amount of more information to truely be able to reconstruct the genome as it was. then again only about 3% is methylated in that fashion...

Only six? (3, Funny)

quokkapox (847798) | more than 7 years ago | (#19361131)

so you could fit almost 6 full humans on a DVD.

Only six? With lossy compression, you could do significantly better, as long as you don't mind all your offspring being funny-but-similar-looking lactose-intolerant non-deterministic sociopathic freaks.

Re:Only six? (0)

Anonymous Coward | more than 7 years ago | (#19362575)

Republicans?

Re:Two DVD disks? (1)

Wolfrider (856) | more than 7 years ago | (#19361659)

--Dude... I think you might have just facilitated the invention of the Transporter, by an order of magnitude... ;-)

The problem is... (1)

DrYak (748999) | more than 7 years ago | (#19362119)

The problem is (currently studying bioinformatics after my medicine)
apparently bioinformaticians have never heard of "compression" or "efficient use of space".

The data (and it's associated metadata) is stored into formated ASCII thus the 12-fold increase of space requirement.

[ Also for all wanna-be-DrEvils on /. : DNA synthesising error rate is low but not negligible, so you can't just "print those 2 DVD and grow your very own DrWatson". Plus cloning is a little bit more complicated than putting some DNA into an ovocyte. ]

Re:Two DVD disks? (1)

RDW (41497) | more than 7 years ago | (#19362781)

But remember that (for the first time, and unlike the current reference assembly) these are diploid genomes, so you have to double those numbers. They're presumably stored as uncompressed ascii for convenience (so around 6Gb of data - maybe they should have used a dual-layer DVD!). However, 2-bit encoding is in fact used where space is at a premium (e.g. to fit a database derived from an entire genome into available RAM for BLAT or BLAST analysis). Here's the scheme used by BLAT:

http://genome.ucsc.edu/FAQ/FAQformat#format7 [ucsc.edu]

With this encoding, you can conformatably create an appropriate database from the ~3Gb reference assembly and BLAT against it on a desktop PC with 1.5Gb RAM.

Metadata (1)

ProfessionalCookie (673314) | more than 7 years ago | (#19363207)

The dataset probably includes certainty coefficients, SNR's or at minimum peak heights from the readers.

Re:Two DVD disks? (1)

troylanes (883822) | more than 7 years ago | (#19360665)

Two DVD disks in each one of our trillions of cells. Pretty amazing data storage density, really. How much of it actually encodes for useful proteins/enzymes/etc may only be a tiny fraction but at some level it's all functional. Perhaps DNA computing will reduce the size/cost/power consumption of data centers someday. Wikipedia DNA Computing [wikipedia.org]

Re:Two DVD disks? (1)

Evil Cretin (1090953) | more than 7 years ago | (#19360711)

It would be interesting (albeit an ethical grey area) if one day we reached a stage where we can create a clone of someone from their genome (i.e. without needing their actual DNA). We'd be able to recreate people hundreds of years after they die.

But we're still rather a while away from being able to stick together billions of base pairs and create a usable piece of DNA. However - it's actually been done before [sciencenews.org] (article is pretty old, I know) with simpler organisms (viruses) and their RNA, so it's not unthinkable...

Limited Rights (5, Funny)

manchineel (699602) | more than 7 years ago | (#19360615)

However, Dr. Watson was told that he could not use his DNA, as it had been patented by the company and any use of his own DNA without proper permission would lead to serious legal consequences...

Re:Limited Rights (0)

Anonymous Coward | more than 7 years ago | (#19361175)

Imagine how bad it would be if they'd used HD-DVD or Blu-Ray!

Re:Limited Rights (1)

PequalsNP (1108219) | more than 7 years ago | (#19361177)

Though your comment is in jest, patents and intellectual property rights for DNA are in many ways trickier than even software patents.

Compressed Humans (1)

Soiden (1029534) | more than 7 years ago | (#19360643)

All this to demostrate humans can be compressed to the size of 2 DVDs!

Re:Compressed Humans (0)

Anonymous Coward | more than 7 years ago | (#19360763)

I'd like to pre-order a Lucy Liu Box set, please.

Re:Compressed Humans (1)

Dunbal (464142) | more than 7 years ago | (#19361067)

I'll see your Lucy Liu and raise you one Uma Thurmann

Re:Compressed Humans (1)

Wolfrider (856) | more than 7 years ago | (#19361695)

--Back of the line, bothayaz... *I* want the Milla Jovovich + Elizabeth Hurley + Lucy Lawless + Mary McDonnell + Uma + Milena Velba + Nadine Jansen + Tricia Helfer + Mickie James + "Victoria" + "Caffeinated Librarian" + Diane Duane boxed set.

--And coldsleep for myself for ~25 years while they grow up and are educated. (And my $$ earns enough Interest in the BG to pay for it all)

--Can you imagine the conversations... and teh sex? ;-)

--They won't be slaves; but they will have a nice profile/background of me, and be encouraged to anticipate my "thawing." Any of them who wants out can do so, as long as they pay off their expenses (which would admittedly be considerable.) They'd have to live onsite, pay rent, and do chores and such while paying it off.
 
// Halfway serious
// Can't afford it :(

Jumping the gun (1)

AirLace (86148) | more than 7 years ago | (#19360653)

It may have been sequenced, but it will be some time before we have the technology to truly "decypher" or unlock the meaning of these sequences. Strikes me as a sensationalist headline.

Re:Jumping the gun (1)

DrMindWarp (663427) | more than 7 years ago | (#19361027)

Correct. Nothing has been decoded or 'decyphered'. It has been sequenced or transcribed.

News stories with DNA are always encumbered with misleading inappropriate terms.

Re:Jumping the gun (1)

cariaso1 (674515) | more than 7 years ago | (#19361851)

In addition to the sequencing being transcribed, it has been analyzed.
  • variations in 310 genes known to cause disease, were found.
  • with 23 which are specifically known to increase the risk of disease
Future analyses will go much further.

www.SNPedia.com [snpedia.com] is a resource to help unravel the effects of these variations. We will cross reference the Watson and Venter genomes as soon as they are actually released. To date, the genomes have not been released.

If anyone can point to where these specific sequences can be found I'd welcome it. In both cases I think the respective journals are holding the sequence until publication.

Real Purpose (1, Funny)

seven7h (926826) | more than 7 years ago | (#19360681)

Blu-Ray - Enough space to store your whole familys DNA!!

Just hope the DRM isn't cracked or people could clone my whole family, DAMN...Too Late

Celera = bad news (4, Interesting)

ushering05401 (1086795) | more than 7 years ago | (#19360735)

Just for anyone not following along:

Celera is a bad news company, and news involving them should always set off alarm bells.

They are decent at motivating people, though. Based on their track record and stated intentions they caused a massive movement to decode the human genome as public property after they announced they would compete with the federally funded decoding initiatives for the purpose of patenting the findings and licensing that data to private companies. As John Sulston, who led the British arm of the Human Genome Project put it: 'We were in a position of responsibility... without us, the human genome would be privatized.'

Here's a quote from The New Atlantis:

"Celera's mission was to sequence the human genome better and faster than its government-funded rival. It aimed to sell access to genomic information as well as the tools to interpret it, with an eye to "big pharma" and other biotechnology companies looking for a treasure trove of new drug targets."

Venter, named in the submission, was the CEO of Celera at the time this strategy was developed and was deposed several months after it became clear that the public would beat Celera to the goal.

This is admitedly troll bait, but I feel a burning personal need to inform people about this man's actions whenever I see his name in print.

Regards.

Re:Celera = bad news (0)

Anonymous Coward | more than 7 years ago | (#19360929)

Venter is an ass. His aim is always to do things quickly and cheaply, getting money and publicity, then let the real scientists come in later and clear away the mess he has made.

He's an ass.

Re:Celera = bad news (1)

lazy genes (741633) | more than 7 years ago | (#19361359)

Venture left the genome project.Then he started Celera in order to patent the genes.He made a godzillion $$$.He built a huge sailboat and hired a military crew to escort him and the cash to an offshore bank on the camen islands.Watson and venture are twins in my book. On the other hand Franklin and Crick were truly saints.

Re:Celera = bad news (2, Insightful)

Rich0 (548339) | more than 7 years ago | (#19362163)

Ah, I remember those days.

Basically, the issue was that the human genome project was operating under a rather long timeline (mostly based on the state of technology when the project started). Venter thought that using a massively-parallel approach to the problem and using computers to assemble the resulting mess of data would get the results faster, but with some gaps in the final data that would require follow-up. He started Celera to implement this idea.

The business model was simple. All the data would be released publicly, but before it was patents would be secured on medical uses for a few hundred new genes that looked to be important. They also offered some database services that in theory would be superior to what was available publicly (although they did publicize their sequences in Genbank/etc).

Suffice it to say the world of academics wasn't too happy about this, as the math on paper suggested that with the amount of capital Celera was commiting he would indeed overtake the HGP (on its original timeline) with time to spare. The reason for this is similar to what you see in distributed computing projects like the RC-5 cracking attempts. If a project stretches 5 years you'll probably see that half of the project got done in the last six months - because of the ever-growing computing power available to it. The whole project could be repeated in 1 year instead of the original 5. The same applied to DNA sequencing technology at the time - the decade-plus-long HGP could be completed in a year or two if started today with the same level of funding. So, starting late didn't really slow down Celera all that much.

In the end Venter's idea essentially paid off. Sure, some complain that the random sequencing technique leaves gaps, but they can be closed conventionally. Also, if you look at most intended uses for sequence data, having 99% of it is just about as good as having 100% of it. And when you look at cost it is probably better to have 99% of 10 organisms sequenced to 100% of one.

The massively-parallel approach to sequencing would probably be of interest to many in the /. crowd - it is essentially an IT solution to an otherwise-expensive problem.

Re:Celera != bad news (0)

Anonymous Coward | more than 7 years ago | (#19362415)

Give me a break troll. Celera was the best thing that every happened to the human genome. The "leaders" of the HGP like Sulston, Francis Collins and Eric Slander were going to sit around for the better part of a decade scratching their hindquarters instead of getting the sequencing done. They were more concerned with dividing up the Nobel Prize than in actually getting the work done. We probably STILL wouldn't have a decently sequenced human, mouse, rat or Drosophila genome if Celera hadn't upset the apple cart.

And for the whole "Evil Celera was going to privatize the genome", PUHLEEEEEEEEEEEEEEZE, that is nothing more than a complete troll by the "leaders" of the HGP once they were shown to be the incompetent twits they are. Try looking at history and thinking rather than buying into the party line from clowns like Sulston. Venter may be an ass, but he got things done, and the HGP has never forgiven him for it.

Uhm... (0)

Anonymous Coward | more than 7 years ago | (#19360751)

That's kind of a creepy gift.

Nature will find a way... (2, Funny)

martin-boundary (547041) | more than 7 years ago | (#19360791)

Oh oh, I hope they double checked the electrical generators at Genbank. If there's a blackout and the frogs get out of the neighbouring lab and mate with Watson's and Rothberg's DNA, we'll soon have a huge Watsosaurus chasing chicken sized Rothoraptors all over North America. Personally, I'm gonna sell my home, buy a Winnabago and settle down right next to the Grand Canyon, the monsters will never find me there!

Congratulations! (1)

311Stylee (106182) | more than 7 years ago | (#19360827)

May the actions of these men lead to greater freedom on information in the future!

Accolades to those brave and capable enough to publish.

The unlocking and sharing of humanity's knowledge is the only way to a successful future (this website is proof enough)!

subject (1)

Doddman (953998) | more than 7 years ago | (#19360853)

I wonder how long it'll be before they get dna sequences of important people and make FoxDie (as in Metal Gear Solid) equivalents


and no I didn't RTFA

CocHk (-1, Offtopic)

Anonymous Coward | more than 7 years ago | (#19360899)

Host what the house FrreBSD went out live and a job to All know we want.

Not DECYPHERED. Start of Personalized PostGenetics (1)

Founder of PostGenet (927571) | more than 7 years ago | (#19361345)

While the term "decyphered" is incorrect (Jim Watson' and Craig Venter' genomes have "only" been REVEALED) - true "decyphering" will be much easier when a statistically significant Personal Genomes will be available. Thus far, it was ZERO (the one published was a "mix"). The two Personal Genomes will be practically identical as far as the "genes" are concerned. However, there will be much diversity in the "non-coding" (formerly "junk") DNA (see ample background at http://www.junkdna.com/ [junkdna.com] "Genomics beyond Genes" will catapult "Personalized PostGenetics".

2 DVD's? (5, Informative)

MikShapi (681808) | more than 7 years ago | (#19361439)

I'm doing undergrad biochem and we've done this math several times, as has been mentioned here in other threads, 1GB is the ballpark amount of space a single UNCOMPRESSED human genome should take up.

On one hand, this is a marginal underestimate because there are more than 4 DNA nucleobases (quite rare, but they exist and need to be recorded if you're profiling a genome).
However, the genome should be quite happily compressable (think bz2 or some specialized lossless form of compression) due to MANY repeating sequences and the fact that most exons (that you'd normally use 6 bits to describe) can be described using 5 bits by pinpointing their product on an amino-acid table (numbering 20 members most of the time), or even 4 bits if you narrow that table from the 20-most-common to the 15-most-common and use the 16th position to describe less-common sequences using more bits, just to name a few reasons.
Maybe a bit of added data they put in describes things we've learned about the data which wasn't physically present in the original DNA such as "here ends intron, here starts exon, here be boundary" etc.

In short, it should be highly compressible and fit in way under 2 DVD's, so for the life of me I can't figure out what they plugged onto two DVDs. Software to decipher it? Gene database correlating what's in your personal genome to what the genes are known to do? Free BonziBuddy extra content? Bonus "behind the scenes" material?

Re:2 DVD's? (2, Funny)

Anonymous Coward | more than 7 years ago | (#19361733)

Bonus "behind the scenes" material?

I'm pretty certain most people don't want to see their very own "making of" documentaries...

Re:2 DVD's? (0)

Anonymous Coward | more than 7 years ago | (#19361879)

... In short, it should be highly compressible and fit in way under 2 DVD's, so for the life of me I can't figure out what they plugged onto two DVDs... Have you considered that those 2 DVDs are the remastered and digitally enhanced version of that scientist's DNA?

Re:2 DVD's? (0)

Anonymous Coward | more than 7 years ago | (#19362129)

You forgot that 3 billion base pairs is the size of the haploid genome while in this case the diploid genome was sequenced, which makes it 6 billion base pairs of information. Also, I don't really get how you get to the 6 bits per base...? Your point about modified bases is good, but the 8 possibilities afforded by 3 bits would be enough to encode those. Anyway, AFAIK current sequencing technologies do not recognize modified bases, so 2 bits would be enough, giving us 1.4GiB without modified bases (and 2.1GiB with modified bases).

Surely they did include annotations on those DVDs, a flat binary file with the sequence wouldn't be of much use, of course. It still is quite a big size difference from 1.4 to 9Gb...

Re:2 DVD's? (2, Informative)

The_mad_linguist (1019680) | more than 7 years ago | (#19362307)

But you can't just point to the animo acid because the codons pointing to the same amino acid don't make the acid fold the same way when introduced to a protein.

Re:2 DVD's? (1)

DerCed (155038) | more than 7 years ago | (#19362591)

Propably not only the sequence itself, but also numerous annotations such as the quality of the sequencing, gene names, functions, references, links to databases, predicted and known functional annotations, etc. etc. etc. etc.!!
There is a lot more interesting information than just the nucleotides.

Re:2 DVD's? (1)

espressojim (224775) | more than 7 years ago | (#19362997)

If you're cool, you'd diff someone's genome against the reference, then compress that result.

This isn't the first genome sequenced, and I have to wonder if the coverage is anywhere near as deep as the reference. My guess is that the coverage is 2-3x at best, and they used the reference as a scaffold for assembly anyway.

This is why the shortcut exists to measure 500K to 1M SNPs per person, since it captures 95+% of the genetic diversity of an individual.

Re:2 DVD's? (1)

Poromenos1 (830658) | more than 7 years ago | (#19363497)

Backup copy!

The Possibilities of Having Genomes Sequenced (1)

Medinole (765009) | more than 7 years ago | (#19361611)

I was at the presentation ceremony myself, and judging from what I heard, Dr Watson (and most in the medical and scientific community) believe that the most important thing which will come from these advances is the ability to make better informed decisions. In sequencing patients genomes: -An employer could blacklist you for being prone to mental illness. -A doctor can be swayed from one drug to another based previously noted reactions in persons with a particular genotype. -You may find out you have an incurable and soon to be debilitating genetic disease. -People can be advised to modify their sun exposure if they have genetic risk factors for skin cancer. -Novel medicines could be developed, tailor made to fit your particular needs. -Parents who don't want to raise a disabled, albino, gay, Downs, hemophiliac or whatever can choose to have their child aborted. Whether this new information will have a positive or negative effect on society is not yet clear, but the blade of knowledge is oft double edged.

The Next Experiment (2, Funny)

CopaceticOpus (965603) | more than 7 years ago | (#19361681)

Now we clone Dr. Watson, place his infant clone in a fake city set at the time of his birth, and see if he will grow up to make the same discoveries.

Or did that already happen? Are we part of the simulation, doomed to ever repeat our part in the story of Watson's life? It's like that Groundhog's Day movie on /.! All posts are reposts!

Sorry, I'm very tired... :)

Re:The Next Experiment (0)

Anonymous Coward | more than 7 years ago | (#19362053)

And all Slashdot articles are dupes. Oh wait...

Judge a scientist by his achievements (1)

BayaWeaver (1048744) | more than 7 years ago | (#19361775)

Some people seem to disapprove of Watson and consider him unworthy of the glory arising from his discovery because of his supposed theft of Rosalind Franklin's data and what he has said about the the human race. Firstly, he didn't steal the data. It was shown to him by her colleague Maurice Wilkins albeit without her knowledge. Other essential data from the Wilkins/Franklin lab were provided to Francis Crick by Max Perutz, Crick's supervisor. He didn't break into her lab to steal it, or sneak a peek at her notebooks when she wasn't around. I think the data was just too important for any one person to have exclusive rights over it. Anyway, the clues were already floating around and available to many. Chargaff's ratios, the X-ray diffraction results. But it was Watson who had the crucial insight about how adenine paired with thymine and guanine with cytosine. And for that and his other contributions, he deserves the glory of his astonishing discovery.

As for his opinions about what he thinks about human nature, our problems, possible solutions, etc, he's just being the very rational person that he is. And it's not very much different from that of many other gifted scientists (eg. Steven Pinker's The Blank Slate). For more about Watson, Crick, Franklin and their contributions to one of the most breathtaking scientific discoveries of all time, I would suggest the following:
Watson, The Double Helix
Crick, What Mad Pursuit
Watson, DNA
Judson, The Eighth Day of Creation
Or at least read Watson's two books before judging or denouncing him.

Re:Judge a scientist by his achievements (0)

Anonymous Coward | more than 7 years ago | (#19363687)

He's accused of theft because he and Crick didn't acknowledge that she had done some of the experimental work they were building their model from in their paper, despite the fact that other (male) scientists whose unpublished work with Xray diffraction was used were cited.

I'm all for knowlege being free, but at least have the decency to acknowledge the people who did the evidence gathering.

Can I run them through diff? (1)

Excel_Spread_Sheep (935029) | more than 7 years ago | (#19361817)

I wonder how big the diff output would be?

whoa one day this will work (1)

kemo_by_the_kilo (971543) | more than 7 years ago | (#19362967)

to copy humans in linux:
dd if=/dev/homosapien of=/dna_backup/insert_name_here-`date +%y%m%d`.iso
cdrecord -v speed=16 dev=2,0,0 /dna_backup/insert_name_here-`date +%y%m%d`.iso

Age of the Amazons upon us? (1)

macraig (621737) | more than 7 years ago | (#19363175)

Perhaps this means that the Amazon society of myth and cheesy science fiction can now take shape? Men won't be needed: women will simply select the DNA of Watson or Venter, add a little randomization from a palette of desirable eugenic traits, insert it into cloned sperm, and voila, one man-less designer baby coming up.

Re:Age of the Amazons upon us? (1)

RDW (41497) | more than 7 years ago | (#19363279)

Yes, and because they already hold the patent they'll be able to do it by 1-Click Ordering!
Load More Comments
Slashdot Login

Need an Account?

Forgot your password?