Beta
×

Welcome to the Slashdot Beta site -- learn more here. Use the link in the footer or click here to return to the Classic version of Slashdot.

Thank you!

Before you choose to head back to the Classic look of the site, we'd appreciate it if you share your thoughts on the Beta; your feedback is what drives our ongoing development.

Beta is different and we value you taking the time to try it out. Please take a look at the changes we've made in Beta and  learn more about it. Thanks for reading, and for making the site better!

First Successful Genome Transplant In Bacteria

kdawson posted more than 7 years ago | from the was-me-now-i'm-you dept.

Biotech 80

eldavojohn writes "Researchers reported the first genome transplant from one bacterium to another, thereby transforming the species from M. mycoides to M. capricolum. The research, published in Science, shows that it is possible to achieve a success rate of 1 in 150,000 genome transplants in bacteria. While this may not seem like very good odds, it's actually a major step towards synthetic life, opening up the possibility of tailoring bacteria to our needs. The article mentions medical uses and fuel production as possible applications."

Sorry! There are no comments related to the filter you selected.

can we do this with gw bush? (-1, Troll)

circletimessquare (444983) | more than 7 years ago | (#20305559)

say from homo idiotus to homo sapiens?

Re:can we do this with gw bush? (0)

Anonymous Coward | more than 7 years ago | (#20305997)

gb2/kuro5hin

Re:can we do this with gw bush? (0)

Anonymous Coward | more than 7 years ago | (#20306013)

They should start with a stupider person, where a slight increase would be much more obvious. Bush earned a Masters in a fairly tough college. Try it out on Algore first, who flunked out of two colleges.

Re:can we do this with gw bush? (1)

sveard (1076275) | more than 7 years ago | (#20306191)

Please... everyone knows 20th century colleges were basically expensive daycare centers.

Re:can we do this with gw bush? (0)

Anonymous Coward | more than 7 years ago | (#20309769)

So, you're saying that Al Gore flunked out of daycare?

Re:can we do this with gw bush? (0)

Anonymous Coward | more than 7 years ago | (#20307001)

There ya go picking on him again. It's not nice to ridicule the handicapped.
And I don't condone any sort of violence. I guess that was Pat Robertsons job.

Some may feel the "no child left behind" education policy didn't work.

But speaking of behinds and education, some would give the current administration credit for helping to resolve to old question:

Why does "assassination" have two "ass"es in it???

Obligatory (1, Funny)

Karl0Erik (1138443) | more than 7 years ago | (#20305609)

Well, I, for one, welcome our new, tailored, microscopic overlords.

Re:Obligatory (0)

Anonymous Coward | more than 7 years ago | (#20310077)

Is there a Greasemonkey filter that'll remove these 'overlords' comments? Even my CAPTCHA is saying 'murder'.

A step forward, but questions remain (3, Insightful)

rritterson (588983) | more than 7 years ago | (#20305639)

While this work is a good step forward toward the ability to insert completely synthetic genomes into living cells, there are some questions left unanswered by the paper that demand answers before the technique can be widely adopted. First, the authors only speculate freely on how the mycoides genome made it into the capricolum cells. It's believed that perhaps two capricolum cells fuse around a mycoides genome, but no evidence to support this claim is given in the paper. Second, the authors do only a single PCR of a single gene to look for the presence of capricolum DNA in the supposed 'new' mycoides cells. This is not nearly enough testing, in my opinion, especially compared to the extensive testing they did on the cells in order to prove the mycoides DNA was present, in it's original genomic form, without insertions.

Until we know how the DNA got there and where the original DNA went, the technique will remain a laboratory curiosity and not something, for example, that can be used in any sort of medical fashion. Still, the paper is fascinating and raises some interesting philosophical questions about what constitutes the information belonging to a species.

Re:A step forward, but questions remain (0)

Anonymous Coward | more than 7 years ago | (#20306097)

Confusing for the snowcloners...

- I for one welcome our M. mycoides, ahh, oh yes (cough), our M. capricolum overlords.

- In Soviet Russia M. mycoides, no, sorry, that should be M. capricolum (oops)... In Soviet Russia M. capricolum synthesizes you...

Re:A step forward, but questions remain (0, Redundant)

PineHall (206441) | more than 7 years ago | (#20306159)

Even simple life is very complex. I am always amazed at how complex simple life really is. Your questions are very good questions that need to be answered. They may not be easy questions to answer.

Simple Complex COMON$ (0)

Anonymous Coward | more than 7 years ago | (#20307519)

Even simple life is very complex. I am always amazed at how complex simple life really is. Your questions are very good questions that need to be answered. They may not be easy questions to answer.

And some /.ers prove how simple complex life can be.

Re:A step forward, but questions remain (2, Funny)

2names (531755) | more than 7 years ago | (#20307567)

IT'S A BIRD!

No wait...IT MIGHT BE A PLANE!

Hold on...OH YEAH, it's AMBIGUOUS MAN!!!!

Re:A step forward, but questions remain (2, Insightful)

stevied (169) | more than 7 years ago | (#20306545)

It's believed that perhaps two capricolum cells fuse around a mycoides genome, but no evidence to support this claim is given in the paper.
I haven't read the paper (not interested enough to pay £££ for it), but there was this in TFA: "They suspect that cell fusion may play an important role in mediating the transplant due to the optimal concentrations of fusion solution." I don't know whether they tried running the experiment multiple times with different concentrations (including zero) of this agent, but if so, a correlation between the concentration and the number of bacteria that survive the antibiotic would be circumstantial evidence in favour the suggested mechanism ..

Re:A step forward, but questions remain (2, Informative)

rritterson (588983) | more than 7 years ago | (#20307303)

That is, again, speculation on the part of the authors. In the paper, the authors only say they believe the cells are fusing because eukaryotic cells also fuse in the same medium, with again no evidence to support the claim. So, we don't even know for sure whether the bacteria are fusing, let alone whether the concentration they used is somehow optimal for fusion to take place.

Re:A step forward, but questions remain (1)

DerangedAlchemist (995856) | more than 7 years ago | (#20306909)

Until we know how the DNA got there and where the original DNA went, the technique will remain a laboratory curiosity and not something, for example, that can be used in any sort of medical fashion. Still, the paper is fascinating and raises some interesting philosophical questions about what constitutes the information belonging to a species.

Actually this is useful as a biotechnology technique without knowing what's going on. Biochemists don't actually know how things like heat shock gets genes into cell either, although they have some theories. "It just works" is perfectly fine for a genetic engineer. Mix and screen for the ones that took up the genes it the method used currently anyway.

Knowing how thoroughly, to screen though and how often only parts of genomes are transfered will be important though. Maybe you would add multiple, different antibiotic genes in different parts of the genome to be transplanted and screen for bacteria that are resistant to all antibiotics simultaneously to try to ensure not only parts were transfered.

Full Science paper.... they did it right.. (4, Informative)

tempest69 (572798) | more than 7 years ago | (#20309303)

http://www.sciencemag.org/cgi/content/full/317/583 8/632 [sciencemag.org]

The authors agreed that a single PCR wasnt enough, so they went with a hindIII digestion and an agarose gel run, to make sure that the pieces were all the right size, and nopt some funky recombination. They also managed a few southern blots to further ensure their results. AND they did 1300 Random Sequences (with luck a sequence can be read to 1000ish base pairs..), and IT ALL MATCHED.... 1.09 million base pairs all fit right...

So my point is that they did the work, made sure it was bulletproof, got accepted into a major journal. And sure they dont know the whole story of whats going on, but it doesnt matter, they DID IT, a full Genome transplant, with proper methods used to ensure its validity..

Storm

Re:A step forward, but questions remain (1)

mok000 (668612) | more than 7 years ago | (#20309449)

We hail our bacterial microlords.

Anyone else? (2, Funny)

MBGMorden (803437) | more than 7 years ago | (#20305665)

Anyone else read this as "First Sucessful Gnome Transplant in Bacteria"? I mean I know they little guys are smart and useful, but that's not reason to be sending them to do the job of nanites :).

You misunderstood (3, Funny)

benhocking (724439) | more than 7 years ago | (#20305937)

They were merely replacing KDE.

Yup, sure did. (1)

Wabbit Wabbit (828630) | more than 7 years ago | (#20306897)

Thank you. I was about to post the same thing.

I think we need to step away from our screens for a while.

Re:Anyone else? (0)

Anonymous Coward | more than 7 years ago | (#20309007)

1. Transplant Gnome genome into randomly selected bacterial lifeform.
2. ???
3. PROFIT!

Re:Anyone else? (1)

Xtravar (725372) | more than 7 years ago | (#20310333)

I guess this gives a whole new meaning to Mono !

Har har har har har!!!

Strong containment (3, Interesting)

jshriverWVU (810740) | more than 7 years ago | (#20305695)

Since this life can be synthetic, there's nothing in nature that is a natural antibiotic. So if there less benign aspects of the new bacteria, and it gets loose in the wild, it has potential to severely damage the ecosystem. Better to plan for the worse case scenario, but hope for the best.

Re:Strong containment (2, Funny)

Silver Sloth (770927) | more than 7 years ago | (#20305857)

Throw the switch, Igor!

Re:Strong containment (3, Insightful)

TheMeuge (645043) | more than 7 years ago | (#20305865)

What are you talking about?

The proteins made by this bacteria are still identical to the parent strain. The cell wall and membrane composition of the recipient cells also don't change. Furthermore, the makeup of all the daughter bacteria will be identical to the parent strain as well. There is nothing new about the daughter cells... and certainly nothing "synthetic" in the way you seem to understand the term.

However, in reference to the article, I wonder... given the ease of transforming bacteria with plasmids... or using recombination-based transduction with phages, what the benefit of whole-genome transfer is, other than to shorten the time required to transfer large blocks of genes.

Re:Strong containment (4, Insightful)

jshriverWVU (810740) | more than 7 years ago | (#20305951)

Agree, at least in respect to what the article did. But down the road if they start doing research on creating custom DNA strands (in essense synthetic life) because it wouldn't be mapped to an identical natural strand. It can potentially be bad. This can also be very good. If they can create a custom made bacteria that attacks cancer cells, or whatever possible health benefits can be made is good. Just making the point they need to make sure they keep the research contained, especially if they start making non-naturally occurring DNA sequences.

Re:Strong containment (1)

ajs (35943) | more than 7 years ago | (#20314599)

But down the road if they start doing research on creating custom DNA strands
What you're trying to describe and what this article are about are radically different things, to the point of having nothing to do with each other.

(in essense synthetic life)
That's a leap of a few orders of magnitude.

because it wouldn't be mapped to an identical natural strand. It can potentially be bad.
Your hypothetical that has nothing to do with this article has the potential to "be bad." Yes.

If they can create a custom made bacteria that attacks cancer cells
Seriously, just stop. You're now writing science fiction. As with much science fiction, your story might one day be possible, but today it has nothing to do with research that's being done.

How did the parent get modded up?

Brought to you ny the (2, Insightful)

geekoid (135745) | more than 7 years ago | (#20305889)

"Ignorance breeds fear" Dept.

Re:Strong containment (5, Informative)

Valar (167606) | more than 7 years ago | (#20305895)

Well, except that wide spectrum antibiotics target whole categories of bacteria. What really matters is the type of cell wall, because that is usually what antibiotics disrupt. As long as the resulting bacteria has a cell wall like the ones in other bacteria (and I see no reason why they wouldn't be designed that way), then we will have no problems, especially if it is a gram positive bacteria.

Re:Strong containment (2, Interesting)

Bearhouse (1034238) | more than 7 years ago | (#20305999)

And how long before somebody designs a bug specifically to resist such antibiotics?

Re:Strong containment (1)

ichigo 2.0 (900288) | more than 7 years ago | (#20306139)

I doubt it would be any worse than the bacteria that are evolving in response to our antibiotic usage.

Re:Strong containment (1)

Bearhouse (1034238) | more than 7 years ago | (#20306361)

Indeed - but do we need any MORE variants of the blasted things?

Re:Strong containment (2, Insightful)

ichigo 2.0 (900288) | more than 7 years ago | (#20306523)

Well no, of course not. But understanding the genome will help us develop countermeasures to evolving threats. Auditing the genes to discover flaws and exploits, if you will.

Re:Strong containment (3, Informative)

Andy Dodd (701) | more than 7 years ago | (#20306315)

The bugs have been successfully designing themselves that way thanks to our good friend evolution.

If someone wants to create an antibiotic-resistant superbug, it would be much easier for them to start with existing antibiotic-resistant bugs and tweak them with existing well-established techniques.

The big news of this article is not that genetic material was transplanted, but that the *full and complete* genome was transplanted. To be honest, while it's an impressive feat, for 99% of the applications mentioned in the article summary, existing "partial genome" transplantation techniques are more than sufficient. People have been doing partial genome transplants with success for nearly three decades now - see http://en.wikipedia.org/wiki/Insulin#Timeline_of_i nsulin_research [wikipedia.org] .

Strong containment unneccessary (1)

DerangedAlchemist (995856) | more than 7 years ago | (#20307083)

Nature has been much, much more successful than any rational design to create antibiotic resistance. All that stuff about abuse of antibiotics, like taking them for viruses, stopping part way through or stupid uses like for cattle feed to promote growth, creates antibiotic resistance incredibly rapidly. And bacteria share these genes across species very frequently, making it especially dangerous. As for the artificial life, it turns out that nature has already very finely tuned bacteria for their jobs. Artificial genes interfere, in fact keeping the genes we want around tends to be the real difficulty because they are so detrimental evolutionarily.

Oblig (1)

n dot l (1099033) | more than 7 years ago | (#20306177)

I for one welcome our new formerly-M.-mycoides-but-now-M.-capricolum overlords.

Re:Strong containment (2, Interesting)

pla (258480) | more than 7 years ago | (#20306247)

Since this life can be synthetic, there's nothing in nature that is a natural antibiotic.

That conclusion doesn't follow from the given premise.

A modern PC counts as 100% synthetic, but dropping it in the ocean will "kill" it quite thoroughly.

Now, if you mean that, in terrestrial life's 3-billion-year long arms-race, no other lifeform has come up with a substance that specifically targets this particular lifeform, I would agree. But that doesn't mean nothing can kill it, just that nothing has killed it yet.

Re:Strong containment (1)

n dot l (1099033) | more than 7 years ago | (#20306377)

So if there less benign aspects of the new bacteria, and it gets loose in the wild
Eh? As far as I understand it we've taken one kind of already existing bacteria and turned it into another kind of already existing bacteria. There really isn't any new kind of bacteria here.

Re:Strong containment (3, Insightful)

tloh (451585) | more than 7 years ago | (#20308175)

There are several concepts that often get muddled in discussions of genetic engineering. A couple things that need to be clarified about your comment:

    In the context of this current example. A genome transplant simply puts an existing set of genes into a microbe that didn't have it before. It isn't synthetic, it is still natural in the sense that it isn't created by man completely from scratch. So existing antibiotic would still be effective if it can target the genome donor.

    Escaping containment is probably not as big a problem as most people think. The reality of the matter is that the principles of evolution works to our favor here. When we do this kind of genetic manipulation, we create something that "works" to our satisfaction. However the methods we use are always very messy and inelegant. A success rate of 1 in 150,000 is mentioned. In order to make the process work for us, we often have to put in extra genes that help us keep track of the bacteria but does nothing to help the microbe live and survive. Our handi-work can never stand toe to toe with nature's evolutionarily derived babies. *Those* guys have had millions(billions) of years to perfect and optimize the process of surviving (and more importantly competing) in the natural environment. Laboratory subjects like the ones mentioned in the article are grown as mono-cultures where you have bacterial medium, the microbe of interest and nothing else. They live like pampered socialites. You put them in the wild and they would completely out-competed by their natural counterparts who have better survival traits like more robust metabolic pathways to better utilize available nutrients or faster response to environmental cues. Within a couple of generations, our lab subjects would most likely be either out competed to extinction or be in such a low activity state as to be insignificant.

    So it is actually the reverse that you need to worry about. Our creation doesn't damage the ecosystem, it is the ecosystem that poses a greater danger to our interests. One of my professors gave a great example that nicely illustrates the situation. Not many people realized that without human intervention, corn can not grow. The food crop that we know as corn has been selectively breed over thousands of years from an ancestral weed that resembles wild grass. Left to itself, a corn field would simply shrivel and die because the plants have no way to disperse it's seeds. (The kernels can't jump out of the husk by themselves.)

    The thing is humans create/modify plants/animals/bacteria for specific purposes of which "natural" survivability is a very low priority. We grow corn primarily so that it can produce big meaty seeds for us to eat. But for that matter it also becomes the favorite food of many other organisms. Sure, we care about how much of the food intended for our stomachs end up in the bellies of crop pests, but the main purpose of growing corn isn't to make them vulnerable to crop pests, it is to feed us and ours.

So in conclusion, any handi-work of ours from the brilliant, but still learning minds of our smartest geneticists would more likely than not, *NOT* menace the natural ecosystem.

Re:Strong containment (1)

blahplusplus (757119) | more than 7 years ago | (#20315171)

"In the context of this current example. A genome transplant simply puts an existing set of genes into a microbe that didn't have it before. It isn't synthetic, it is still natural in the sense that it isn't created by man completely from scratch. So existing antibiotic would still be effective if it can target the genome donor."

Any intervention is necessarily synthetic, since the bacteria is just not going to transplant a genome on its own without out our intervention. Just because the structure is 'natural' doesn't mean the resulting organism can't be understood to be 'synthetic'. (since it would have never occured without our intervention).

Re:Strong containment (1)

tloh (451585) | more than 7 years ago | (#20325111)

Let me ask you a question:

When a person receives a heart transplant, do you now refer to the recipient as a "synthetic human" who has undergone a "synthetic procedure"?

I think you would be hard pressed to find anyone who would reply "yes". The word "synthetic" would be a very poor choice to identify any items referred to in this current context. In any case, it seems you're missing the forest for the trees here. The point is that if the genome came from *somewhere*, rather than out of *nowhere*, any antibiotic that would have targeted that *something* from *somewhere* would be equally effective against the genome recipient.

Re:Strong containment (1)

blahplusplus (757119) | more than 7 years ago | (#20325425)

The point your missing of course is the HISTORY of that particular slice or reality, that organism has a synthetic history (i.e. it would not have occurred without us mucking about).

Juts because I take a natural twig and glue it to a rock, does not make history of it's combination a naturally occurring phenomena.

Unless the bacteria transplanted a genome into itself, it is not a naturally occurring phenomena (in this context), it is ARTIFICIAL (in this context).

When a person gets a heart transplant he is using an artificial (man made) process to replace his heart, if his heart would replace itself then we can argue for it's naturalness' (whatever that really means, truly, the word 'natural' is a weasal word imho, it does more to obfuscate then clarify).

Re:Strong containment (1)

tloh (451585) | more than 7 years ago | (#20327087)

Well, "artificial" would certainly be a much more appropriate substitution for "synthetic". I guess you are entitled to your own opinion about what you want to call something. Technical jargon in any field can be irritating/frustrating. But I would strongly caution you to use different words to express yourself in different company. I am a lab technician on the staff of the Biotechnology program at the local JC. I just showed our discussion to a few of the instructors (my bosses) this afternoon. They're molecular biologists and geneticists with experience in both industry and academia and none of them have ever encountered anyone who uses the terminology in the quit the same way you did.

    (Two of them have said some not so nice things about you and some of the other posters who have contributed comments. However, they don't read slashdot and don't know what goes on around here. :-P)

    In much of the literature we keep here as references, the word "synthetic" has a very consistent meaning. It usually refers to the assembly or putting together of smaller parts - as in the synthetic process of DNA replication or, protein building, or synthetic polymer. The fact that this process of genome transplant is an human induced process can not be denied. But so what? No one is saying otherwise. However, the transplant process has nothing to do with the ability of antibiotics to act against a familiar target which has always existed in the form of the donor bacteria. The big deal here is that *what* is being transplanted is not artificial or man-made at all. As provided by a donor, the transplanted genome comes with an established history of interaction with everything the donor has ever evolutionarily encountered. THAT part of the picture doesn't have any human interaction (or twigs or rocks) involved. So for example, any phage that the genome donor was susceptible to would likely be able to infect the transplant recipient. Any environmental niche the genome donor inhabited would support the transplant recipient. etc. etc.

Re:Strong containment (1)

blahplusplus (757119) | more than 7 years ago | (#20327863)

We were just misunderstanding one another that's all...

You were using 'synthetic' in one context, I was using it in another (since many words have different meanings based on not only USAGE in different CONTEXTS) we just got our contexts mixed up that's all.

As for your colleagues they're just being anal retentive, it's one thing to one perfectionistic accuracy it's another to have the social tact and not be so quick to run our mouths when we are just having a misunderstanding.

Remember each persons mind is a universe unto itself, that's one thing I've learned in my life and to be aware of interpretive context (i.e. If someone says such and such, one thinks of one valid meaning in one context, and the other person in another, not that they are "incorrect" it's just the vaguary and vulgarity of language).

Just so you know: Tell your colleagues that language is vulgar, visualization trumps language any day of the weak. Einstein was such a genius because he was a visual thinker "If I can't visualize it I can't understand it".

Re:Strong containment (1)

Starcub (527362) | more than 7 years ago | (#20315459)

Our creation doesn't damage the ecosystem, it is the ecosystem that poses a greater danger to our interests.

Arrogant crap. It's unbelievable what passes for scholarship in modern times.

One of my professors gave a great example that nicely illustrates the situation. Not many people realized that without human intervention, corn can not grow.

C'mon now, what he should have said is that corn as we have it today wouldn't exist, and even that you couldn't be sure of ...with crows and whatnot... man need not be the source of the crop.

The food crop that we know as corn has been selectively breed over thousands of years from an ancestral weed that resembles wild grass.

There's a big difference between GM and breeding. With GM we are attempting to control the building blocks of life to create life according to our limited purposes. Breeding allows for creation to evolve in ways that God, 'nature' if that bothers you, allows for. You don't have to know much to get successful results from selective breeding, but even presuming good intentions, there is the possibility that the resultant life might negatively impact the ecosystem. The danger is even greater when you are dealing manipulating the genome of any lifeform. There's always something that man doesn't understand.

The thing is humans create/modify plants/animals/bacteria for specific purposes of which "natural" survivability is a very low priority.

Not necessarily, humans do those things primarily to maximize profit... the driving factor is the bottom line -- that's the problem. Survivability is a big part of profitability as is increasing the size of a crop. There is also the desire to increase resistance to pesticides, to reduce crop resource consumption requirements, to shorten crop growth cycle time, etc... How do you suppose impact to the environment weighs in on the scale of profitablility?

 
Corn is a primary example of what I'm talking about here, look up Monsanto's GM corn and it's contamination of organic crops if you don't know.

So in conclusion, any handi-work of ours from the brilliant, but still learning minds of our smartest geneticists would more likely than not, *NOT* menace the natural ecosystem.

So long as mr. murphy is dealt a hand, there a chance that his will win. So what would you you define as acceptable loss?

Re:Strong containment (1)

tloh (451585) | more than 6 years ago | (#20334483)

Arrogant crap. It's unbelievable what passes for scholarship in modern times.
I'm sorry my scholastic aptitude upsets you. However, I don't think it is arrogant to suggest that our meddlings in genetics are much more vulnerable to the power of the entire ecosystem than the other way around. Quit the opposite, I think it is very humbling to realize that mother nature can often take our very best effort and use it as asswipe.

C'mon now, what he should have said is that corn as we have it today wouldn't exist, and even that you couldn't be sure of ...with crows and whatnot... man need not be the source of the crop.
That's kind of self-evident, don't you think? I'm not sure what crows have to do with anything. But I'm guessing you might be referring to the possibility of crows (or maybe other birds) co-evolving with ancestral corn as seed dispersers. Examples are well documented for other species. But if this is true for corn and specifically crows, farmers the world over would be all over this fact. However, I don't know of any scientific evidence for this evolutionary interspecies relationship. I'd be very interested to look into any thing you can present, though.

There's a big difference between GM and breeding.....
Quite right! But those differences often turns out to be multiple ways to skin a cat.

You don't have to know much to get successful results from selective breeding....
Perhaps not, but you *would* need a lot more time and resources (both human and material) to achieve with selective breeding what can be now done routinely with genetic engineering. Since we're talking about corn, an example would be appropriate. Many years ago, a gene called opaque-2 was discovered in a mutant variety of corn that dramatically raised the amount of lysine and tryptophan in the kernel. As two essential amino acids some animals (including us humans) can not produce on their own, the inclusion of opaque-2+ maize had dramatic effects on nutritional health of those fed with such a diet. Pigs raised on such a diet gained weight at 3 times the normal rate. However, isolating the amino acid production trait in the mutant from other undesirable traits took hundreds of scientists ~ 20 years to accomplish using traditional cross-hybridization techniques. Nowadays with genetic engineering, this kind work takes a fraction of the resources at a fraction of the time. The two methods both accomplish the same objective. But why would you want to waste all that time, manpower, and money with obsolete methods?

There's always something that man doesn't understand.
I suppose that is why some opt for a divinely guided world view where it is okay not to seek explanations or solutions to the questions that confound us. But so far, it doesn't seem to have been of any benefit in terms of human progress or enlightenment. We're not going to feed the hungry or make notable breakthroughs by simply basking in all that we don't know. It is good to experiment and try new things - that's what science is all about.

Not necessarily, humans do those things primarily to maximize profit......Corn is a primary example of what I'm talking about here, look up Monsanto's GM corn and it's contamination of organic crops if you don't know.
You are absolutely right! Profit is a higher priority than *natural* survivability. I don't know how information about Monsanto is being filtered through to you. But what they are now doing with crops and crop seeds illustrates exactly the *opposite* of what you are arguing about. Given a choice, they *don't* want their GM corn to be spreading anywhere. Rather than continuing suing anyone for having a contaminated field, they are now pushing to sell seeds that no longer spread seeds or reproduce beyond the first generation. This way, farmers would be forced to buy seeds from them year after year after year. These new crops they are trying to sell have absolutely *NO* natural survivability. Zero. Zilch. Without humans, they do not exist. period.

So long as mr. murphy is dealt a hand, there a chance that his will win. So what would you you define as acceptable loss?
I'm not so sure I agree with you on exactly which side murphy is on. So far as we've been witness to, our natural ecosystem has very often be extremely resilient even in the face of our sustained assault on the "natural order of things". As I'm learning everyday, I continue to be amazed at how mother nature can swallow our biggest man-made disasters without so much as a burp. No matter what happens, Earth and life on Earth will survive us. Depending how how reckless and irresponsible we are, *WE* might not survive *IT*. The ecosystem have nothing to fear from us.

childhood songs (3, Funny)

wolfgang_spangler (40539) | more than 7 years ago | (#20305805)

[singsong]
one of these 150,000 things is not like the others..
while they both would kill goats if they had their 'drothers...
one of these is different, can't you see...
without a cell wall it should be easy...
[/singsong]

I'd like to take this portion of the post to apologize...

First Success? (2, Funny)

weinrich (414267) | more than 7 years ago | (#20305961)

What are they talking about? I successfuly transplanted one of my Gnomes from the side garden to the front garden just last week. I even have pictures to prove it! How can they claim to be the first?

Re:First Success? (1)

iggymanz (596061) | more than 7 years ago | (#20306217)

GNOME pffft, wake us up when you've done a successful KDE transplant

more importantly... (1)

Tumbleweed (3706) | more than 7 years ago | (#20306163)

This means they're one step closer to creating Dark Angel, which I think we can all agree, is vastly more important. :)

Re:more importantly... (2, Funny)

ArhcAngel (247594) | more than 7 years ago | (#20307613)

This means they're one step closer to creating Dark Angel, which I think we can all agree, is vastly more important.

I think they've already developed the beautiful woman who won't give you the time of day and can kick your ass.

Re:more importantly... (0)

Anonymous Coward | more than 7 years ago | (#20310915)

Already been done, and thankfully put out of her misery after two seasons.

The only downside is it lead to Fox signing "Firefly", leading to millions of nerds whining about the (to everyone else inevitable) early cancellation of that awful series to this day.

Gray Goo! (1)

tedgyz (515156) | more than 7 years ago | (#20306227)

Gray Goo! Gray Goo! Gray Goo!

Um, that would be "green goo". (1)

Spy der Mann (805235) | more than 7 years ago | (#20306341)

Gray goo is a blob made of self-replicating nanomachines. Green goo is the biological version.

Little do they really understand. (3, Interesting)

bradbury (33372) | more than 7 years ago | (#20306399)

The problem with this news article is that most people hearing about it and commenting on it are clueless with respect to what it means and doesn't mean.

It means that someone walked into your house took all the old furniture out and replaced it with a whole bunch of different but similar furniture so that when you got home in the evening you could still sit down on the couch and watch TV.

So what everyone is going gaga over is the fact that the movers can take furniture out and replace it with different furniture. To be honest, I'm not that impressed. It has *nothing* to do with synthetic life, artificial life, etc. because they are *still* using the few hundred enzymes that nature had to evolve over billions of years. They didn't sit down and design a totally new basis for self-replicating systems that can survive in our "real" world and make a copy of itself. The hard drive in your computer is significantly more impressive. It has more parts and using a single command I can get it to copy itself. And *we* humans had to design every single circuit and craft every single part in it. Now *thats* something to be impressed with.

Re:Little do they really understand. (1)

decipher_saint (72686) | more than 7 years ago | (#20306571)

If I replaced you every night with your clone implanted with identical memories would you be cool if you found out about it?

Human nature:
4. Fear
3. Anger
2. ???
1. Understanding

Re:Little do they really understand. (1)

bradbury (33372) | more than 7 years ago | (#20308015)

I don't have a particular attachment to my current instantiation. A copy is a copy is a copy. And if it had really identical memories I don't see how he (I) would realize that he (I) was a copy. I do realize of course that there are people who don't happen to feel this way.

Re:Little do they really understand. (1)

Loconut1389 (455297) | more than 7 years ago | (#20313523)

Check for the dots under your eyelids...

Oh, they understand (0)

Anonymous Coward | more than 7 years ago | (#20307141)

It has *nothing* to do with synthetic life, artificial life, etc. because they are *still* using the few hundred enzymes that nature had to evolve over billions of years.
The parts might not be unique or synthetic, but at least this combination is a unique, creative work. In other words, eligible for copyright, DMCA protections, etc. ;-)

Re:Little do they really understand. (2, Insightful)

SpinyNorman (33776) | more than 7 years ago | (#20310731)

The first wetware implementations of artificial life will of course be using nature's building blocks, but you have to start somewhere. What this work provides is an "test environment" for running the artifical DNA that Venter et al are designing.

I'm sure that later (maybe within our lifetime) we'll be able to design out own life forms completely from scratch, but rather ironically intelligent design really is the hard way to do it. Nature used the dumb brute force algorithm (cf Deep Blue playing chess) of running a gazillion experiments in parallel and doing so for hundreds of millions of years ... we don't yet have the capability of exploring the search space so thoroughly, but a local exploration from a known good point (i.e. artificial DNA) is a different matter.

Re:Little do they really understand. (1)

bradbury (33372) | more than 7 years ago | (#20311349)

No, no, no. You can of course start with "nature's building blocks" but you don't have to start there. Feynman and Drexler made that perfectly clear. There is "Plenty of Room at the Bottom". And taking a bunch of furniture out of one house and moving it into another house is not what I would classify as a brilliant achievement. Indeed, I suspect one would have to really work determining those cases where one cannot move the furniture from one house to another.

And it is not a given that the first wetware implementation of artificial life will require the cumbersome machinery that nature has left us with. The key point is that it is *NOT* "artificial" if you are using nature's building blocks. You did not sit down at a computer, you did not design the enzymes, you did not synthesize the DNA in the lab to produce those enzymes, you did not test them to verify how well they worked and so on and so forth.

You are operating from the perspective that conscious minds could not come up with a significantly better system than that which nature has handed to us using its trail and error processes. I would hate to think that is the case.

There is a line in "Chorus Line" where the individual says "I can do that". That is what one has here. I can emplace some DNA and have the existing machinery copy that DNA so as to produce more bacteria. The principles behind this have been known for decades.

Re:Little do they really understand. (1)

SpinyNorman (33776) | more than 7 years ago | (#20312565)

Sigh.

"I'm sure that later (maybe within our lifetime) we'll be able to design out own life forms completely from scratch".

I meant "of course the first wetware implementation of artificial life will use nature's building blocks" as a matter fact not of necessity. Craig Venter's "minimal life form" artificial DNA should be upon us in months and will of course be "executed" by inserting it into a living organism per this type of genome transplant technology. However superficial you regard this line of research, it is still by definition artifical life. Call it "partly artifical" if you want to be pedantic.

Re:Little do they really understand. (1)

bradbury (33372) | more than 7 years ago | (#20315635)

The point would be that we have been engineering microorganisms with human designed and manufactured DNA, by your definition "artificial life", for decades, . Such exercises are done at hundreds of universities and companies on a regular basis. Once the sequences have been read (and over a thousand of them are now sitting in databases) the only real barrier to assembling a synthetic genome is cost. And this group hasn't even done that -- all they did was move a genome into a foreign house. And bacterial viruses have been doing that for billions of years.

Article is useless (3, Informative)

the_kanzure (1100087) | more than 7 years ago | (#20306499)

Most informative part:

The researchers explained that the transplantation method is simple in concept, though complicated to execute. First, the proteins were stripped from the M. mycoides LC cells, resulting in naked DNA that can be passed between cells. Then this intact DNA was incubated briefly with M. capricolum cells, soaking in a solution that caused the M. capricolum cells to fuse together. As two of these recipient cells fused, they sometimes encapsulated a donor DNA chromosome.
And then the citation:

Lartigue, Carole, Glass, John I., Alperovich, Nina, Pieper, Rembert, Parmar, Prashanth P., Hutchison III, Clyde A., Smith, Hamilton O., and Venter, J. Craig. Genome Transplantation in Bacteria: Changing One Species to Another. 3 August 2007, Vo. 317, Science.
Abstract:

Originally published in Science Express on 28 June 2007
Science 3 August 2007:
Vol. 317. no. 5838, pp. 632 - 638
DOI: 10.1126/science.1144622

Genome Transplantation in Bacteria: Changing One Species to Another
Carole Lartigue, John I. Glass,* Nina Alperovich, Rembert Pieper, Prashanth P. Parmar, Clyde A. Hutchison, III, Hamilton O. Smith, J. Craig Venter

As a step toward propagation of synthetic genomes, we completely replaced the genome of a bacterial cell with one from another species by transplanting a whole genome as naked DNA. Intact genomic DNA from Mycoplasma mycoides large colony (LC), virtually free of protein, was transplanted into Mycoplasma capricolum cells by polyethylene glycol-mediated transformation. Cells selected for tetracycline resistance, carried by the M. mycoides LC chromosome, contain the complete donor genome and are free of detectable recipient genomic sequences. These cells that result from genome transplantation are phenotypically identical to the M. mycoides LC donor strain as judged by several criteria.

The J. Craig Venter Institute, Rockville, MD 20850, USA.

* To whom correspondence should be addressed. E-mail: jglass@jcvi.org
But would it be too painful to actually add in relevant information from the published article? Not all of us know where to go get "Science" [sciencemag.org] , nor do we have magical access [aaas.org] . Slashdot editors, if you would be so kind- stop accepting articles about papers behind paywalls. Some of us want to actually discuss the contents of these articles, the research methods, to look into what's actually going on ... not this hype that tells us nothing and wastes our time. ("You must be new!")

Anyway, genome transplantation means that maybe we can get the genome of our stem cells transplanted into bacteria. Just store lots of stem cell DNA, and then one day start the procedure to make the bacteria uptake the DNA and--- well, the current problem with this is that the human genome is much different from bacterial genomes, and so there will undoubtedly be way too many problems with the host bacteria, i.e. trying to make some of the proteins and biomolecules that actually causes self-destruction, but the concept/hope is still there.

BTW, the group that this article is about has been taking up way too much of our collective attention:
* Team claims synthetic life feat [slashdot.org]
* Venter Institute claims patent on synthetic life [slashdot.org]
* and now this.
And I should probably link over to this site [syntheticbiology.org] .

Re:Article is useless (1, Informative)

Anonymous Coward | more than 7 years ago | (#20307227)

Genome Transplantation in Bacteria: Changing One Species to Another
Carole Lartigue, John I. Glass,* Nina Alperovich, Rembert Pieper, Prashanth P. Parmar, Clyde A. Hutchison, III, Hamilton O. Smith, J. Craig Venter

As a step toward propagation of synthetic genomes, we completely replaced the genome of a bacterial cell with one from another species by transplanting a whole genome as naked DNA. Intact genomic DNA from Mycoplasma mycoides large colony (LC), virtually free of protein, was transplanted into Mycoplasma capricolum cells by polyethylene glycol-mediated transformation. Cells selected for tetracycline resistance, carried by the M. mycoides LC chromosome, contain the complete donor genome and are free of detectable recipient genomic sequences. These cells that result from genome transplantation are phenotypically identical to the M. mycoides LC donor strain as judged by several criteria.

The J. Craig Venter Institute, Rockville, MD 20850, USA.

* To whom correspondence should be addressed. E-mail: jglass@jcvi.org

It has been known ever since Oswald Avery's pioneering experiments with pneumococcal transformation more than six decades ago, that some bacteria can take up naked DNA (1). This DNA is generally degraded or recombined into the recipient chromosomes to form genetic recombinants. DNA molecules several hundred kilobase pairs (kb) in size can sometimes be taken up. In recent studies with competent Bacillus subtilis cells, Akamatsu and colleagues (2, 3) demonstrated cotransformation of genetic markers spread over more than 30% of the 4.2-megabase pair (Mb) genome using nucleoid DNA isolated from gently lysed B. subtilis protoplasts. Artificial transformation methods that employ electroporation or chemically competent cells are now widely used to clone recombinant plasmids. Generally, the recombinant plasmids are only a few kilobase pairs in size, but bacterial artificial chromosomes (BACs) greater than 300 kb have been reported (4). Recombinant plasmids coexist with host-cell chromosomes and replicate independently. Two other natural genetic transfer mechanisms are known in bacteria. These are transduction and conjugation. Transduction occurs when viral particles pick up chromosomal DNA from donor bacteria and transfer it to recipient cells by infection. Conjugation involves an intricate mechanism in which donor and recipient cells come in contact and DNA is actively passed from the donor into the recipient. Neither of these mechanisms involves a naked DNA intermediate.

In this paper, we report a process with a different outcome, which we call "genome transplantation." In this process, a whole bacterial genome from one species is transformed into another bacterial species, which results in new cells that have the genotype and phenotype of the input genome. The important distinguishing feature of transplantation is that the recipient genome is entirely replaced by the donor genome. There is no recombination between the incoming and outgoing chromosomes. The result is a clean change of one bacterial species into another.

Work that is related to the process we describe in this paper has been carried out or proposed for various species. Itaya et al. transferred almost an entire Synechocystis PCC6803 genome into the chromosome of a recipient B. subtilis cell using the natural transformation mechanism. The resulting chimeric chromosome had the phenotype of the B. subtilis recipient cell. Most of the Synechocystis genes were silent (5). A schema for inserting an entire Haemophilus influenzae genome as overlapping BACs into an Escherichia coli recipient has also been proposed; however, those authors have pointed out difficulties arising from incompatibility between the two genomes (6). Transplantation of nuclei as intact organelles into enucleated eggs is a well-established procedure in vertebrates (7-9). Our choice of the term "genome transplantation" comes from the similarity to eukaryotic nuclear transplantation in which one genome is cleanly replaced by another.

Genome transplantation is a requirement for the establishment of the new field of synthetic genomics. It may facilitate construction of useful microorganisms with the potential to solve pressing societal problems in energy production, environmental stewardship, and medicine. Chemically synthesized chromosomes must eventually be transplanted into a cellular milieu where the encoded instructions can be expressed. We have long been interested in defining a minimal genome that is just sufficient for cellular life (10, 11) and have advocated the approach of chemically synthesizing a genome as a means for testing hypotheses concerning the minimal set of genes. The societal and ethical implications of this work have been explored (12, 13).

Fabricating a synthetic cell by this approach requires the introduction of the synthetic genome into a receptive cytoplasm. We chose mycoplasmas, members of the class Mollicutes, for building a synthetic cell. This choice was based on a number of characteristics specific to this bacterial taxon. The essential features of mycoplasmas are small genomes, use of UGA to encode tryptophan (rather than a stop codon), and the total lack of a cell wall. A small genome is easier to synthesize and less likely to break during handling. The altered genetic code facilitates cloning in E. coli because it curtails the expression of mycoplasma proteins. The absence of a cell wall makes the exterior surfaces of these bacteria similar to the plasma membranes of eukaryotic cells and may simplify our task of installing a genome into a recipient cell by allowing us to use established methods for insertion of large DNA molecules into eukaryotic cells.

We elected to develop our genome transplantation methods using two fast-growing mycoplasma species, Mycoplasma mycoides subspecies mycoides, Large Colony strain GM12, and Mycoplasma capricolum subspecies capricolum, strain California kid, as donor and recipient cells, respectively. They divide every 80 and 100 min, respectively. These organisms are both opportunistic pathogens of goats, but can be grown in the laboratory under Biosafety Level 2 conditions. In preparation for our experiments, it was necessary to sequence both genomes and compare them to determine the degree of relatedness. We found that 76.4% of the 1,083,241-bp draft sequence of the M. mycoides LC genome (14) could be mapped to the 1,010,023-bp M. capricolum genome (15), and this content matched on average at 91.5% nucleotide identity. The remaining ~24% of the M. mycoides LC genome contains a large number of insertion sequences not found in M. capricolum.

At the outset, we explored a number of methods for genome transplantation. The process had three key phases: isolation of intact donor genomes from M. mycoides LC, preparation of recipient M. capricolum cells, and installation of the isolated genome into the recipient cells. We chose our donor and recipient cells for genome transplantation on the basis of our observation that plasmids containing a M. mycoides LC origin of replication complex (ORC) can be established in M. capricolum, whereas plasmids with an M. capricolum ORC cannot be established in M. mycoides LC (16).

Donor Genomic DNA Preparation

Manipulation of whole chromosomes in solution exposes the DNA to shear forces that can cause breakage. Thus, it was important to minimize genome manipulation during the detergent and proteolytic enzyme treatments by suspending the cells in agarose blocks. Intact chromosomes were immobilized in the resulting cavern in the agarose that originally held the cell. Digested protein components, lipids, RNAs, and sheared genomic DNAs could then be removed by dialysis or electrophoresis from the immobilized intact genomic DNA.

Whole, intact genomic DNA isolation was performed using a CHEF Mammalian Genomic DNA Plug Kit from Bio-Rad. Briefly, we grew M. mycoides LC cells containing tetracycline-resistance (tetM) and ß-galactosidase genes (lacZ) (17) at 37C to moderate density in SP4 medium (18), supplemented with 10 g/ml of tetracycline and, in some experiments, 10 g/ml of streptomycin. Fifty to 100 ml of cultured cells was reduced to a pellet by centrifugation at 4575g for 15 min at 10C. We resuspended cells in 20 ml of 10 mM Tris (pH 6.5) plus 0.5 M sucrose; spun as before; and resuspended again in 1 ml (~1 to 5 x 109 cells/ml). We incubated the cell suspension for 15 min at 50C, then mixed it with an equal volume of 2% low-melting-point (LMP) agarose in 1x TAE buffer [40 mM Tris-acetate and 1 mM EDTA]. After 5 min at 50C, the mixture of cells and LMP agarose (2 ml) was distributed in 100-l aliquots into plug molds. The 20 plugs solidified at 4C. Embedded mycoplasma cells were lysed and proteins were digested at 50C for 24 hours by addition of 6 ml of proteinase K reaction buffer [100 mM EDTA (pH 8.0), 0.2% sodium deoxycholate, and 1% sodium lauryl sarcosine] with 240 l of proteinase K (>600 U/ml). The 20 plugs were then washed four times at room temperature for 1 hour in 20 ml of 1x Tris-EDTA buffer [Tris-HCl (20 mM) and EDTA (50 mM), (pH 8.0)] with agitation and stored in 10 ml of Tris-EDTA buffer at 4C.

We wanted to confirm that our gentle preparation of the genomic DNAyielded intact circular molecules. We subjected some agarose plugs to pulsed-field gel electrophoresis (PFGE) in a 1% LMP gel in TAE, with contour-clamped homogeneous electric field (19) (CHEF DR III, Bio-Rad). Pulse times were ramped from 60 to 120 s over 24 hours at 3.5 V/cm. After migration, plugs were removed from the wells and stored in 10 ml of Tris-EDTA buffer (as described above) at 4C until used as source of intact genomic DNA for chromosome transplantation experiments. During PFGE, intact circular bacterial chromosomes become caught in the agarose and do not migrate, whereas full-length linearized DNA, as well as smaller DNA fragments, RNAs, proteins, and any other charged cellular molecules remaining after the detergent and enzyme digestion were removed from the plug by electrophoresis (20). A SYBR gold (Molecular Probes)-stained pulsed-field gel (Fig. 1A) showed a band of DNA that had the same electrophoretic mobility as a 1.125-Mb linear DNA size marker (about the same size as the M. mycoides LC genome), plus an intense band at the position of the wells, which suggested that a large amount of DNAwas still in the plugs. Extensive digestion of the plug and the excised ~1.125-Mb band with Plasmid-Safe adenosine triphosphate (ATP)-dependent deoxyribonuclease (DNase) (Epicentre Biotechnologies) clearly degraded the excised ~1.125-Mb band (Fig. 1B). Plasmid-Safe ATP-dependent DNase digests linear double-stranded DNA to deoxynucleotides and, with lower efficiency, closed-circular and linear single-stranded DNA. The enzyme has no activity on nicked or closed-circular double-stranded DNA or supercoiled DNA. This is compatible with the presence of a large amount of circular genomic DNA in the plug. As we became more experienced with genome isolation, the amount of apparently linearized DNA in our preparations diminished.

Figure 1 Fig. 1. Demonstration that the DNA in the blocks was intact and circular, whereas the DNA in the band that migrated into the gel was linear. (A) A pulsed-field gel loaded with a plug containing M. mycoides LC DNA. The 1x TAE buffer gel was separated by electrophoresis for 20 hours and then stained with SYBR gold. The marker lane contains Bio-Rad Saccharomyces cerevisiae genomic DNA size markers. Note the large amount of DNA remaining in the plug. (B) The plugs are shown either before PFGE or after PFGE, and the genome sized band produced after PFGE, and either with or without treatment with the Plasmid-Safe DNase. The nuclease enzyme digests linear DNA, but has no effect on circular duplex DNA. These data indicate the band of DNA that migrated into the gel was exonuclease-sensitive and, therefore, linear. [View Larger Version of this Image (60K GIF file)]

We analyzed the plugs to confirm that the DNA encased in them was naked. Plugs loaded on SDS polyacrylamide gels after boiling in SDS showed no detectable protein by silver staining, which indicated that the majority of the DNAwas naked (Fig. 2). In order to make sure that the DNA was completely deproteinated during the genome transplantation, agarose plugs treated with detergent and proteinase K were subjected to liquid chromatography followed by tandem mass spectrometry(LC-MS/MS) on an ion-trap mass spectrometer (21). Five M. mycoides peptides, each for a different protein and from a separate plug, were identified (table S1). Because LC-MS/MS analysis is very sensitive and provides excellent sequence coverage, the peptide quantities are extremely small. Only one peptide per protein was detected, which makes it highly unlikely that any undigested proteins were present in these agarose plug samples. In addition, we detected no M. mycoides LC peptides in plugs not exposed to PFGE. There was also a background in the samples run on PFGE of many peptides not encoded by M. mycoides LC, such as keratin peptides. All of these peptides, including the five encoded by M. mycoides LC, could be contaminants introduced during the PFGE.

Figure 2 Fig. 2. SDS-polyacrylamide gel electrophoresis (SDS-PAGE) analysis of isolated M. mycoides LC DNA in agarose blocks shows that there were no detectable proteins associated with the DNA. The gels were silver-stained. (Left) The three lanes labeled "Intact cells" were three dilutions of M. mycoides LC cells that were boiled in SDS and loaded onto the gel. (Middle) Agarose blocks with the M. mycoides LC DNA that were boiled in SDS and loaded on the protein gel either before (B) or after (A) PFGE. (Right) To determine whether the material at the top of the gel was protein or DNA, we treated the blocks, before and after PFGE, with DNase I. One of the markers was DNase I. [View Larger Version of this Image (64K GIF file)]

The final step in donor genome preparation entailed liberation of the DNA from agarose encasement. Before transplantation experiments, the agarose plugs containing M. mycoides LC genomic DNA (before or after PFGE) were washed 2 times 30 min in 1 ml of 0.1 x Tris-EDTA buffer [Tris-HCl (2 mM) and EDTA (5 mM) (pH 8.0)] with gentle agitation. The buffer was completely removed, and the agarose plugs were melted at 65C with 1/10th volume of 10x ß-agarase buffer [10 mM bis Tris-HCl (pH 6.5) and 1 m MEDTA] for 10 min. The molten agarose was cooled for 10 min to 42C and incubated overnight at the same temperature with 2.5 units of ß-agarase I (New England Biolabs) per 100 l of plug. We calculated each plug contained ~10 g of DNA (~8 x 109 genomes).

Recipient Cell Preparation and Genome Transplantation Reaction Conditions

We prepared the M. capricolum recipient cells in a 6-ml culture of SOB medium (22) containing 17% fetal bovine serum and 0.5% glucose. Incubation was at 37C until the medium pH was 6.2. Cells (5 to 50 x 107 cells/ml) were then spun in a centrifuge at 4575g for 15 min at 10C. As pH decreased from 7.4 to 6.2, regular ovoid M. capricolum cells changed shapes dramatically. Cells became longer, thinner, and branched. In poor medium, inhibition of DNA replication due to nucleotide starvation is known to induce branching in M. capricolum cells (23, 24). Cells were washed once [Tris 10 mM and NaCl 250 mM (pH 6.5)], resuspended with 200 l of CaCl2 (0.1 M), and held on ice for 30 min. During that period, 20 l of ß-agarase-treated plugs (~50 ng/l) were delicately transferred into 400 l of SP4 medium without serum [SP4 (-)], with wide-bore genomic pipette tips, and incubated 30 min at room temperature. For the genome transplantation, M. capricolum cells mixed with 10 g of yeast transfer RNA (Invitrogen) were gently transferred into the 400 l of SP4 (-) containing 20 l of M. mycoides LC whole-genomic DNA. An equal volume of 2x fusion buffer [Tris 20 mM, NaCl 500 mM, MgCl2 20 mM, polyethylene glycol 8000 (PEG; USB Corporation no. 19959) 10%] was added, and the contents were mixed by rocking the tube gently for 1 min. After 50 min at 37C, 10 ml of SP4 was added, and the cells were incubated for 3 hours at 37C to allow recovery. Finally, cells were spun at 4575g for 15 min at 10C, resuspended in 0.7 ml of SP4, and plated on SP4 agar plates containing 3 g/ml tetracycline and 150 g/ml X-gal (5-bromo-4-chloro-3-indolyl ß-D-galactopyranoside).

The plates were incubated at 37C until large blue colonies, putatively M. mycoides LC, formed after ~3 days. Sometimes, after ~10 days smaller M. capricolum colonies, both blue and white, were visible. Thus, all of these colonies were tetracycline-resistant, as evidenced by their surviving the antibiotic selection, and only some expressed ß-galactosidase. These colonies might be the result of recombination. We observed that these colonies appeared after almost twice as many days as it took for the transplants to become visible (25). Individual colonies were picked and grown in broth medium containing 5 g/ml of tetracycline. During propagation, the tetracycline concentration was progressively increased to 10 g/ml. When we first developed this technique, we subjected all plugs to PFGE. Later, we found this step was unnecessary. We observed no significant difference in transplantation yield as a result of PFGE of the plugs.

Every experiment included two negative controls. To ensure that the M. mycoides genomic DNA contained no viable cells, one control was processed exactly as described above except no M. capricolum recipient cells were used. Similarly, in another control, M. capricolum recipient cells were mock-transplanted without any donor DNA. The results of a series of experiments are shown in Table 1. No colonies were ever observed in controls lacking recipient cells; thus, the donor DNA was free of any viable contaminating M. mycoides LC cells. When donor DNA and recipient cells were both present, from 1 to >100 putative transplants were obtained in individual experiments. As we became more experienced with this technique, the yield of transplant colonies increased.

View this table:
[in this window]
[in a new window]

            Table 1. Results of a series of transplantation experiments.

Analysis of Putative Transplants

The blue, tetracycline-resistant colonies resulting from M. mycoides LC genome transplantation were to be expected if the genome was successfully transplanted. However, colonies with that phenotype could also result from recombination of a fragment of M. mycoides LC genomic DNA containing the tetM and lacZ genes into the M. capricolum genome. To rule out recombination, we examined the phenotype and genotype of the transplanted clones.

Genotype analysis. We analyzed several transplant clones after synthesis with the polymerase chain reaction (PCR) using primers specific for each species to determine whether the putative transplants had M. mycoides LC sequences other than the selected tetM and lacZ marker genes. We used PCR primers specific for IS1296 insertion sequences, which are present in 11 copies in the sequenced M. mycoides LC genome, but are absent in the M. capricolum genome. Similarly, we used PCR primers specific for the M. capricolum arginine deiminase gene, which is not present in M. mycoides LC. The IS1296 PCR produced an amplicon only when the template was the M. mycoides wild-type strain or was one of the transplanted clones. Similarly, the M. capricolum arginine deiminase PCR generated an amplicon with the M. capricolum template DNA, but not with the M. mycoides LC wild-type DNA or DNAs from transplant clones. The PCR experiments left open the possibility that fragments of the M. mycoides LC genome containing an IS1296, the tetM gene, and the lacZ gene had recombined into the M. capricolum genome in such a way that they destroyed the arginine deiminase gene (fig. S1). A more convincing genotypic analysis that looked at the overall genome used Southern blot analysis of the donor and recipient mycoplasmas and a series of putative transplants. Genomic DNA from each of those species was digested with the restriction enzyme Hind III and run on a 1% agarose gel. Southern blots were prepared and probed with IS1296 sequences. As expected, no probe hybridized to the wild-type M. capricolum lane (Fig. 3A). We did this analysis on every transplant we obtained, as well as a series of M. mycoides LC clones (Fig. 3B). Analysis of Southern blots of 37 wild-type M. mycoides LC clones and 75 putative transplants showed that 34 (92%) and 44 (59%), respectively, were essentially identical to the M. mycoides LC donor DNA blot; the rest showed variations in the banding patterns. We assume that variation was the result of IS element transposition. We hypothesize that mobility of the IS1296 element may be somewhat suppressed in M. mycoides LC cells. However, there may be no suppression of transposon mobility immediately following introduction of the donor genome into the M. capricolum cytoplasm. This is evidence of a transitional period when the M. mycoides LC donor genomes reside in a cellular milieu whose M capricolum content is initially high, but diminishes with each cell division. Next, we did sample sequencing of whole-genome libraries generated from two transplant clones. Our analysis of more than 1300 random sequence reads from the genome of each clone (totaling ~1.09 million bases for each clone) showed that all reads matched M. mycoides LC sequence (26). We cannot rule out the possibility that small regions of the donor genomes recombined with identical regions of M. capricolum recipient cell genome; however, those regions would be very small. There are 20 identical regions of between 395 and 972 base pairs. The above results were all consistent with the hypothesis that we have successfully introduced M. mycoides LC genomes into M. capricolum followed by subsequent loss of the capricolum genome during antibiotic selection.

Figure 3 Fig. 3. Southern blots of (A) 75 transplants and (B) 37 different M. mycoides LC filter clones. The blots were probed with a PCR amplicon that hybridized to the IS1296 insertion sequences. Although different samples all had multiple copies of the IS1296, they had slightly different patterns on the blots, which indicated movement of the element. For the transplants (A), the donor cell genomes are shown in the single lanes. As a control (B), Southern blots of recipient cells (wild-type M. capricolum) are shown in the single lane. The IS196 probe from M. mycoides LC genomic DNA was amplified by PCR using primers IS1296P1F (AAGCGTTTAGAATAGAAGGGCTA) and IS1296P1R (CTGAATTGTACAGGAGACAATCC). [View Larger Version of this Image (102K GIF file)]

Phenotype analysis. We examined the phenotype of the transplanted clones in two ways. In one, we looked at single-gene products characteristic of each of these two mycoplasmas. Using colony-Western blots, we probed donor and recipient cell colonies and colonies from four different transplants with murine antibodies specific for the M. capricolum VmcE and VmcF surface antigens and with murine antibodies specific for the M. mycoides LC VchL surface antigen. In both assays, M. mycoides LC VchL-specific antibodies bound the transplant blots with the same intensity as it bound the M. mycoides LC blots (Fig. 4). Similarly, the antibodies specific for the M. capricolum VmcE and VmcF did not bind the to the transplant blots. In the second, proteomic analysis, cell lysates of all three strains were examined by using differential display in two-dimensional electrophoresis (2-DE) gels, followed by identification of proteins spots with matrix-assisted laser desorption ionization (MALDI) mass spectrometry. The 2-DE spot patterns of the M. mycoides LC and the transplanted clone were identical within the limits of 2-DE; however, the M. capricolum 2-DE spot patterns were very different. More than 50% of the respective spots could not be matched among the gels (Fig. 5, A to C). More evidence was gained from MALDI-MS data that the transplant proteome was identical to the M. mycoides LC proteome and did not have any M. capricolum features. For nearly 90 identified spots of the transplant, confidence scores obtained with the Mascot algorithm were invariably equal or higher for M. mycoides LC than for M. capricolum proteins, despite high sequence homologies; although there were nine protein spots with confidence scores that indicated they were derived from M. capricolum genes, each case proved to be an artifact of either sequencing errors or gene boundary annotation errors (table S2). As an example, Fig. 5D visualizes peptides in acetate kinase matching only the sequence of the respective M. mycoides LC protein. Thus, the phenotypic assays affirmed that the transplants were likely M. mycoides LC and were not the result of a M. capricolum-M. mycoides LC mosaic produced by recombination between the donor and recipient cell genomes after the transplantation of the M. mycoides LC genome and before the two genomes segregate during cell division.

Figure 4 Fig. 4. Colony hybridization of the M. mycoides LC (genome donor), M. capricolum (recipient cell), and transplants from four different experiments that were probed with a polyclonal antibody specific for the M. capricolum VmcE and VmcF surface antigens or with monoclonal antibodies specific for the M. mycoides LC VchL surface antigen (29). [View Larger Version of this Image (79K GIF file)]

Figure 5 Fig. 5. Proteomic analysis. Two-dimensional gels were run using cell lysates from (A) M. mycoides LC, (B) M. capricolum, and (C) a transplant clone (11.1). Standard conditions were used for the separation of protein spots in the first dimension on immobilized pH gradient (IPG) strips (pH range 4 to 7) and in the second, SDS-PAGE, dimension (molecular mass 8 to 200 kD) (30). The gels were stained with Coomassie brilliant blue G-250, and 96 spots were excised from each of the gels. Spots 71 (A), 23 (B), and 8 (C) were identified as acetate kinase. (B) M. capricolum acetate kinase showed a clear alkaline pH shift. The sequence coverage map for trypsin-digested peptides obtained from MALDI-MS peptide mass fingerprint (PMF) data localizes peptide sequences of acetate kinase [spot 8 (C)] matching mass/charge ratio (m/z) values in the PMF. Peptide sequences in red were identical to the two Mycoplasma species; peptide sequences in blue were unique to M. mycoides LC. [View Larger Version of this Image (97K GIF file)]

Optimization of Genome Transplantation Efficiency

To determine what factors govern genome transplantation efficiency, we varied the number of M. capricolum recipient cells and the amount of M. mycoides LC genomic DNA used in transplantation experiments. Transplant yield was optimal when 107 to 5 x 107 cells were used. At lower donor DNA concentrations, there was a linear relation between the amounts of genomic DNA transplanted and transplant yield. Yields began to plateau at higher donor DNA concentrations (Fig. 6).

Figure 6 Fig. 6. Genome transplantation as a function of the amount of M. mycoides LC genomic DNA transplanted. Transplant colonies were observed on two different plates. We observed no colonies on either the no-recipient-cell control or the mock-transplanted control plates. [View Larger Version of this Image (23K GIF file)]

Concluding Remarks

These data demonstrate the transplantation of whole genomes from one species to another such that the resulting progeny are the same species as the donor genome. However, they do not explain the mechanism of the transplant. This is not natural DNA transformation, where linear DNA enters the cytoplasm and recombines into the resident chromosome. Our genome transplantation does not entail recombination, and our donor molecule is circular. In addition, our recipient mycoplasma cells have not been shown to be competent for natural transformation, nor are any DNA uptake genes identified in the M. capricolum genome. We presume that organisms carrying both donor and recipient cell genomes occurred at least transiently at early times after transplantation. Only 1 recipient cell in ~150,000 was transplanted in our most efficient experiments. This low efficiency has so far prevented a demonstration of transient mosaicism. Although our donor and recipient are distinct species, they are phylogenetically close relatives. Genome transplantation works for the species we have chosen, but we do not know for what other species it will work.

Because mycoplasmas are similar to mammalian cells with respect to their lack of a cell wall, we experimented with a series of approaches that are effective for transferring large DNA molecules into eukaryotic cells. These included cation- and detergent-mediated transfection, electroporation, and compaction of the donor genomes using various cationic agents. None of those approaches proved effective for whole-genome transplantation (see SOM). Our PEG-based method may be akin to PEG-driven cell fusion methods developed for eukaryotic cells. To test this hypothesis, two parental strains of M. capricolum, one carrying a tetM marker in the chromosome and the other one with the chloramphenicol-resistance marker (CAT) in a stable ORC plasmid, were both prepared as "recipient" cells, mixed, and incubated in the presence of the fusion buffer as described above for transplantation experiments. We plated cells on SP4 agar containing both tetracycline (3 g/ml) and chloramphenicol (50 g/ml). In the presence of 5% PEG, we obtained progeny resistant to both antibiotics. No colonies grew in the absence of 5% PEG. The number of colonies increased ~30 times when we pretreated cells with CaCl2. Sequencing analysis of 30 clones showed that all had both the tetM and CAT markers in the cells at the expected chromosomal and plasmid locations. Thus, we concluded that with our PEG-based method, M. capricolum cells fuse. Those results agree with membrane studies by Rottem and colleagues demonstrating that fusion of M. capricolum cells is maximal in 5% PEG (27). Gene transfer into Mycoplasma pulmonis was also mediated by PEG at concentrations likely to fuse cells, albeit only small DNA segments are transferred (28). We can imagine that, in some instances, the cells may fuse around the naked M. mycoides LC genomes. Those genomes, now encapsulated in M. capricolum cytoplasm, express the tetM protein, which allows the large fused cells to grow and divide once plated on the SP4 agar containing tetracycline. Cells lacking the M. mycoides genome do not grow. Eventually, now, in the absence of PEG and through a process of cell division and chromosome segregation, normal, albeit tetracycline-resistant, ß-galactosidase-producing M. mycoides cells produce large blue colonies on the plate. This basic approach of PEG-mediated genome transplantation may allow other species to be transplanted with naked genomes containing antibiotic-resistance genes.

Some bacterial cells have multiple large chromosomes. This suggests the existence of natural mechanisms for chromosome transfer between species. However, we have no evidence that genome transplantation as described here occurs in nature. We observed that in the absence of treatment with detergent and proteinase K, nucleoids from M. mycoides LC cells would not produce transplants. Given the improbability of the natural occurrence of free-floating bacterial genomes that are both deproteinized and intact, genome transplantation could be a phenomenon unique to the laboratory. Still, we have discovered a form of bacterial DNA transfer that permits recipient cells to be platforms for the production of new species with the use of modified natural genomes or manmade genomes generated by the methods being developed by synthetic biologists.

References and Notes

        * 1. O. T. Avery, C. M. MacLeod, M. McCarty, J. Exp. Med. 79, 137 (1944).[Abstract]
        * 2. T. Akamatsu, H. Taguchi, Biosci. Biotechnol. Biochem. 65, 823 (2001). [CrossRef] [Medline]
        * 3. Y. Saito, H. Taguchi, T. Akamatsu, J. Biosci. Bioeng. 101, 334 (2006). [CrossRef] [ISI] [Medline]
        * 4. H. Shizuya et al., Proc. Natl. Acad. Sci. U.S.A. 89, 8794 (1992).[Abstract/Free Full Text]
        * 5. M. Itaya, K. Tsuge, M. Koizumi, K. Fujita, Proc. Natl. Acad. Sci. U.S.A. 102, 15971 (2005).[Abstract/Free Full Text]
        * 6. R. A. Holt, R. Warren, S. Flibotte, P. I. Missirlis, D. E. Smailus, Bioessays 29, 580 (2007). [CrossRef] [ISI] [Medline]
        * 7. I. Wilmut, A. E. Schnieke, J. McWhir, A. J. Kind, K. H. Campbell, Nature 385, 810 (1997). [CrossRef] [Medline]
        * 8. J. B. Gurdon, J. A. Byrne, Proc. Natl. Acad. Sci. U.S.A. 100, 8048 (2003).[Abstract/Free Full Text]
        * 9. R. Briggs, T. J. King, Proc. Natl. Acad. Sci. U.S.A. 38, 455 (1952).[Free Full Text]
        * 10. J. I. Glass et al., Proc. Natl. Acad. Sci. U.S.A. 103, 425 (2006).[Abstract/Free Full Text]
        * 11. C. A. Hutchison III et al., Science 286, 2165 (1999).[Abstract/Free Full Text]
        * 12. M. K. Cho, D. Magnus, A. L. Caplan, D. McGee, Science 286, 2087 (1999).[Free Full Text]
        * 13. M. S. Garfinkel, D. Endy, G. E. Epstein, R. M. Friedman, Synthetic Genomics: Options for Governance (report of the project "Synthetic Genomics: Risks and Benefits for Science and Society," funded by Alfred P. Sloan Foundation of New York), in preparation.
        * 14. This whole-genome shotgun project has been deposited at DNA Database of Japan (DDBJ), European Molecular Biology Laboratory (EMBL), and GenBank under the project accession AAZK00000000. The version described in this paper is the first version, AAZK01000000.
        * 15. GenBank accession number NC_007633.
        * 16. C. Lartigue, A. Blanchard, J. Renaudin, F. Thiaucourt, P. Sirand-Pugnet, Nucleic Acids Res. 31, 6610 (2003).[Abstract/Free Full Text]
        * 17. The donor cells containing the tetM and lacZ genes were made through integration of an M. mycoides LC ORC plasmid [see (16)] containing those genes near the M. mycoides LC ORC. The location of the plasmid insertion can be seen in the genome sequence.
        * 18. J. G. Tully, D. L. Rose, R. F. Whitcomb, R. P. Wenzel, J. Infect. Dis. 139, 478 (1979). [ISI] [Medline]
        * 19. G. Chu, D. Vollrath, R. W. Davis, Science 234, 1582 (1986).[Abstract/Free Full Text]
        * 20. S. M. Beverley, Nucleic Acids Res. 16, 925 (1988).[Abstract/Free Full Text]
        * 21. Materials and methods are available as supporting material on Science Online.
        * 22. D. Hanahan, J. Mol. Biol. 166, 557 (1983). [ISI] [Medline]
        * 23. S. Seto, M. Miyata, J. Bacteriol. 180, 256 (1998).[Abstract/Free Full Text]
        * 24. S. Seto, M. Miyata, J. Bacteriol. 181, 6073 (1999).[Abstract/Free Full Text]
        * 25. To minimize the risk of contaminating our transplant cultures with M. mycoides LC cells from our donor genome preparation process, we used three different hoods for our cell culture work: one for M. mycoides LC donor cell preparation, one for M. capricolum, and one for working with transplant clones.
        * 26. There was no sequence that was unique to M. capricolum. Of the 24 reads that did not match the M. mycoides LC or M. capricolum genome sequences, most were either very short reads (200 bases) or the result of chimeric clones, which is to be expected owing to the active transposons in M. mycoides LC and also as part of library construction. The data for the two transplant clones that were sequenced are posted at the National Center for Biotechnology Information, NIH, NCBI Trace File Archives (accession numbers 1807995910 through 1807998555).
        * 27. M. Tarshis, M. Salman, S. Rottem, Biophys. J. 64, 709 (1993). [ISI] [Medline]
        * 28. A. M. Teachman, C. T. French, H. Yu, W. L. Simmons, K. Dybvig, J. Bacteriol. 184, 947 (2002).[Abstract/Free Full Text]
        * 29. The murine antibodies were gifts from M. Foecking, T. Martin, K. Wise, and M. Calcutt at the University of Missouri.
        * 30. C. L. Gatlin et al., Proteomics 6, 1530 (2006). [CrossRef] [ISI] [Medline]
        * 31. We thank C. Merryman, L. Young, and N. Assad-Garcia for many discussions about genome transplantation; and D. Rusch, G. Sutton, S. Yooseph, and J. Johnson for bioinformatics analyses. The bulk of the work was supported by Synthetic Genomics. The proteome analysis was funded in part through the Pathogen Functional Genomics Resource Center, managed and funded by the Division of Microbiology and Infectious Diseases, National Institute of Allergy and Infectious Diseases, NIH, Department of Health and Human Services, and operated by the J. Craig Venter Institute. J.C.V. is Chief Executive Officer and Co-Chief Scientific Officer of Synthetic Genomics, Inc., a privately held entity that develops genomic-driven strategies to address global energy and environmental challenges. H.O.S. is Co-Chief Scientific Officer and on the Board of Directors of Synthetic Genomics, Inc. C.A.H. is Chairman of the Synthetic Genomics, Inc., Scientific Advisory Board. All three of these authors hold Synthetic Genomics, Inc., stock, and the J. Craig Venter Institute owns a significant fraction of Synthetic Genomics, Inc. Following the disclosure policy of this journal, the authors disclose that the Venter Institute has filed for a patent application on some of the techniques described in this paper.

Supporting Online Material

www.sciencemag.org/cgi/content/full/1144622/DC1

Re:Article is useless (1)

mapkinase (958129) | more than 7 years ago | (#20311021)

Just store lots of stem cell DNA
It seems like you need the whole shebang of the cell (epigenomics) as well.

Mycoplasma genitalium (1)

AcetylCoA (1144169) | more than 7 years ago | (#20306527)

"The scientists want to synthesize this genome, called Mycoplasma genitalium, using only simple chemicals." Did anyone else go "WTF!?!?" when they mentioned this name? Hmm.. although transplanting a naturally found genome to another similar bacterial cell doesn't seem like much, this actually means that once they're able to synthesize a minimum genetic sequence for basic cell function, like the one named above, they'll have a good chance of injecting the new genome into them and thus they will have just about total control over the cell's functions.

put my genome into Paris Hilton (1)

peter303 (12292) | more than 7 years ago | (#20306619)

One way or another :-)

Would this be like one of those "mind transplant machines" then?

The first steps (1)

c_woolley (905087) | more than 7 years ago | (#20307251)

Great, so we have confirmed the first steps to bio-war through mutating germs...or we can hope that people actually use it for good intent. Of course, the road to hell is paved with good intentions.

This stuff does honestly scare me. The optimist in me realizes the benefits we can cultivate. The realist in me knows that this could honestly be far worse than a nuclear bomb.

I'd like to place an order for... (4, Funny)

xednieht (1117791) | more than 7 years ago | (#20307433)

...opening up the possibility of tailoring bacteria to our needs.

some bacteria to wash my dishes and pick up my stuff.

Re:I'd like to place an order for... (0)

Anonymous Coward | more than 7 years ago | (#20311517)

Lemme guess, your mom got tired of your bacterial experiments in the basement? :-)

Re:I'd like to place an order for... (0)

Anonymous Coward | more than 7 years ago | (#20316621)

and one bunch to grow some thc crystals :)

Bioshock (2, Funny)

Anonymous Coward | more than 7 years ago | (#20308021)

OK, now the viral marketing for Bioshock has officially gone too far...

Re:Bioshock (1, Funny)

Anonymous Coward | more than 7 years ago | (#20309035)

That's bacterial marketing, you insensitive clod!

Mutation? (1)

Merritt.kr (1120467) | more than 7 years ago | (#20311259)

Am I the only one, that when I hear these things, thinks "Mutation" ? I can just see "We made a new bacteria to help us!" ... a few years later, "Oh no, the bacteria mutated and now it's going to wipe out 98% of the world's population!"

Re:Mutation? (1)

JustNiz (692889) | more than 7 years ago | (#20315055)

No you're not the only one.
This REALLY worries me too. Mankind is not ready to be trusted with this sort of power and responsibility. We have a terrible record of allowing big corporations to screw up nature for their short-term financial gain, while we pay the long-term price.

Re:Mutation? (1)

cnettel (836611) | more than 7 years ago | (#20315995)

Yeah, I suggest an immediate ban on yoghurt.
Check for New Comments
Slashdot Login

Need an Account?

Forgot your password?